Incidental Mutation 'R4454:Fam227b'
ID329075
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Namefamily with sequence similarity 227, member B
Synonyms4930525F21Rik
MMRRC Submission 041714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4454 (G1)
Quality Score188
Status Validated
Chromosome2
Chromosomal Location125983483-126152004 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 126146268 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
Predicted Effect probably benign
Transcript: ENSMUST00000110446
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110448
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably benign
Transcript: ENSMUST00000178118
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype Mice homozygous for a knock-out allele exhibit abnormal coat appearance, abnormal kidney morphology, spleen hypoplasia, decreased vesicles clustering in GABAergic synapses, decreased miniature inhibitory postsynaptic currents, and increased susceptibility to drug-induced seizures.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,753 E163G probably damaging Het
AI481877 T C 4: 59,092,383 D266G possibly damaging Het
Ap4e1 T A 2: 127,047,141 F509I probably damaging Het
Asmt A T X: 170,672,721 M19L probably benign Het
Atf6 C T 1: 170,794,039 R471Q probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Baiap3 T A 17: 25,249,536 D250V probably damaging Het
C2cd4d T A 3: 94,363,747 F107I probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cldn6 T C 17: 23,681,086 probably null Het
Cpa5 A G 6: 30,626,324 N228S possibly damaging Het
Crocc T C 4: 141,020,405 S1478G possibly damaging Het
Csmd1 A T 8: 15,945,011 C2675S probably damaging Het
Cthrc1 C A 15: 39,077,013 Q4K probably benign Het
Ddo A T 10: 40,647,547 I178F probably damaging Het
Dmxl1 A G 18: 49,893,332 T1836A probably benign Het
Dnah9 T G 11: 66,147,389 Q107P probably damaging Het
Dusp26 A G 8: 31,094,144 N93S probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Epha5 T C 5: 84,156,444 I501V probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fgd5 C T 6: 91,989,186 S642F probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gm12034 T A 11: 20,446,476 noncoding transcript Het
Gm13023 A G 4: 143,792,824 S52G probably benign Het
Liph T C 16: 21,984,268 D17G probably benign Het
Mbd3 A T 10: 80,393,983 L164H probably damaging Het
Med4 A G 14: 73,518,062 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nav2 A T 7: 49,548,544 probably null Het
Olfr728 T C 14: 50,140,496 I48V probably benign Het
Olfr904 C A 9: 38,464,642 F200L probably benign Het
Pcdha11 G A 18: 37,007,373 G685D probably benign Het
Pgc A G 17: 47,732,410 I228V probably benign Het
Rad51 C T 2: 119,131,568 H199Y probably damaging Het
Robo2 A T 16: 74,352,519 probably benign Het
Sap130 C T 18: 31,711,360 T861I probably damaging Het
Sh3tc2 A T 18: 62,007,773 D1061V probably damaging Het
Snapc3 A G 4: 83,418,759 E119G probably damaging Het
Sspo G A 6: 48,487,225 G3862D probably benign Het
Tbc1d16 G A 11: 119,157,873 T318M possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Thsd1 T C 8: 22,243,578 Y214H probably damaging Het
Tnfrsf13b T C 11: 61,141,438 V98A probably benign Het
Topbp1 T C 9: 103,344,871 Y1314H probably damaging Het
Ttn C A 2: 76,785,806 V8271L possibly damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utrn G T 10: 12,727,840 Q599K possibly damaging Het
Zfp995 G A 17: 21,879,951 T434I probably benign Het
Zfy1 G T Y: 725,518 T749K possibly damaging Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 126144325 critical splice acceptor site probably null
IGL00970:Fam227b APN 2 126127060 missense probably benign 0.01
IGL02040:Fam227b APN 2 126121084 splice site probably benign
IGL02095:Fam227b APN 2 126101004 missense probably damaging 0.97
IGL02352:Fam227b APN 2 126146254 unclassified probably benign
IGL02359:Fam227b APN 2 126146254 unclassified probably benign
IGL02506:Fam227b APN 2 126003911 missense probably benign 0.22
IGL02717:Fam227b APN 2 126003843 missense probably null 0.97
IGL02933:Fam227b APN 2 126123988 splice site probably null
IGL03064:Fam227b APN 2 126126842 splice site probably null
IGL03086:Fam227b APN 2 126119031 missense probably benign 0.01
IGL03198:Fam227b APN 2 126124579 critical splice donor site probably null
IGL03256:Fam227b APN 2 125989003 missense probably damaging 0.99
IGL03368:Fam227b APN 2 126119063 missense probably damaging 1.00
dana UTSW 2 126116123 missense probably damaging 1.00
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0110:Fam227b UTSW 2 126100921 missense probably damaging 1.00
R0140:Fam227b UTSW 2 126124603 missense possibly damaging 0.53
R0377:Fam227b UTSW 2 126125000 splice site probably benign
R0499:Fam227b UTSW 2 126100909 missense probably benign 0.25
R1240:Fam227b UTSW 2 126124585 missense possibly damaging 0.56
R1356:Fam227b UTSW 2 126119008 missense probably damaging 1.00
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R2055:Fam227b UTSW 2 126100954 missense probably benign 0.13
R2884:Fam227b UTSW 2 126100926 missense probably benign 0.01
R3124:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3125:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3937:Fam227b UTSW 2 126127060 missense probably benign 0.01
R4408:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4455:Fam227b UTSW 2 126146268 unclassified probably benign
R4457:Fam227b UTSW 2 126146268 unclassified probably benign
R4558:Fam227b UTSW 2 126127043 missense probably benign 0.00
R4661:Fam227b UTSW 2 126007310 missense probably damaging 0.99
R4809:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125987939 missense probably benign 0.01
R4989:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5011:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5013:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5014:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5133:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5184:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5431:Fam227b UTSW 2 126126931 missense probably benign 0.09
R5797:Fam227b UTSW 2 126007334 missense probably benign
R6056:Fam227b UTSW 2 126121052 missense probably damaging 1.00
R6218:Fam227b UTSW 2 126126962 missense probably damaging 1.00
R6471:Fam227b UTSW 2 126121065 missense probably damaging 1.00
R6660:Fam227b UTSW 2 126144307 missense probably damaging 1.00
R6734:Fam227b UTSW 2 126126976 nonsense probably null
R7136:Fam227b UTSW 2 126124028 missense probably damaging 0.99
R7410:Fam227b UTSW 2 126119063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTCCATGCAGGCTTCTCAG -3'
(R):5'- TGCTCAGGTTCTGGAATTCAAAAC -3'

Sequencing Primer
(F):5'- GCTTCTCAGCACCAGGC -3'
(R):5'- CAGGTTCTGGAATTCAAAACTGTAAG -3'
Posted On2015-07-21