Incidental Mutation 'R4455:1700102P08Rik'
ID329150
Institutional Source Beutler Lab
Gene Symbol 1700102P08Rik
Ensembl Gene ENSMUSG00000032611
Gene NameRIKEN cDNA 1700102P08 gene
Synonyms
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4455 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108392805-108410934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108397196 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 166 (H166R)
Ref Sequence ENSEMBL: ENSMUSP00000035234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035234] [ENSMUST00000035237] [ENSMUST00000192995] [ENSMUST00000194959]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035234
AA Change: H166R

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000035237
SMART Domains Protein: ENSMUSP00000035237
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 1.39e-46 SMART
Pfam:Ubiquitin_3 139 226 6.7e-34 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 919 2.2e-84 PFAM
Pfam:UCH_1 302 507 2.8e-8 PFAM
Pfam:UCH_1 605 901 1.4e-15 PFAM
low complexity region 927 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192995
Predicted Effect probably benign
Transcript: ENSMUST00000193288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194939
Predicted Effect probably benign
Transcript: ENSMUST00000194959
SMART Domains Protein: ENSMUSP00000141368
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.7e-30 PFAM
Pfam:UCH 254 872 7e-89 PFAM
Pfam:UCH_1 255 469 3.5e-8 PFAM
Pfam:UCH_1 566 854 2.5e-14 PFAM
low complexity region 880 891 N/A INTRINSIC
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aktip T C 8: 91,124,851 E248G probably benign Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Arfgef3 A T 10: 18,607,675 S1434T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Bbs12 T C 3: 37,320,312 V418A probably damaging Het
Cacnb4 A G 2: 52,465,653 V214A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
H3f3a G T 1: 180,803,103 R129S probably benign Het
Hfm1 T C 5: 106,886,508 probably null Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Krtap16-1 A T 11: 99,985,733 C282S probably benign Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Mllt1 A G 17: 56,919,965 Y71H probably damaging Het
Ms4a14 T A 19: 11,303,626 T523S possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rela T A 19: 5,647,262 I499K probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in 1700102P08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:1700102P08Rik APN 9 108397406 missense probably damaging 1.00
R1199:1700102P08Rik UTSW 9 108393477 missense possibly damaging 0.71
R1885:1700102P08Rik UTSW 9 108393610 missense possibly damaging 0.84
R1886:1700102P08Rik UTSW 9 108393610 missense possibly damaging 0.84
R1887:1700102P08Rik UTSW 9 108393610 missense possibly damaging 0.84
R4926:1700102P08Rik UTSW 9 108395299 missense probably damaging 0.98
R5282:1700102P08Rik UTSW 9 108393240 start codon destroyed probably null 1.00
R5645:1700102P08Rik UTSW 9 108397204 missense probably damaging 1.00
R6318:1700102P08Rik UTSW 9 108393275 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACCTTATATTGGTGCTCGCTTG -3'
(R):5'- TGATCATCCAAAGCCTGCTTG -3'

Sequencing Primer
(F):5'- GCAGTTGGCAGTGCTCTTC -3'
(R):5'- TTGAGGCTACCAGGGTCAG -3'
Posted On2015-07-21