Incidental Mutation 'R4456:Olfr643'
ID329189
Institutional Source Beutler Lab
Gene Symbol Olfr643
Ensembl Gene ENSMUSG00000109824
Gene Nameolfactory receptor 643
SynonymsMOR13-2, GA_x6K02T2PBJ9-6793628-6792684
MMRRC Submission 041716-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4456 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103998800-104137405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104059300 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 101 (S101P)
Ref Sequence ENSEMBL: ENSMUSP00000150133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074064] [ENSMUST00000138055] [ENSMUST00000217217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074064
AA Change: S101P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073707
Gene: ENSMUSG00000090219
AA Change: S101P

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2.6e-124 PFAM
Pfam:7TM_GPCR_Srsx 37 255 3.1e-7 PFAM
Pfam:7tm_1 43 294 3.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217217
AA Change: S101P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,942,245 F1210L probably benign Het
Amfr C T 8: 93,984,940 A323T possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cdc42ep1 A G 15: 78,849,891 E397G possibly damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Dnmt1 T C 9: 20,909,842 T1250A probably damaging Het
Dst A T 1: 34,190,719 K2642N probably benign Het
Emcn A T 3: 137,379,847 K69* probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fbxo38 G T 18: 62,526,249 R326S probably damaging Het
Fcer1g A G 1: 171,234,239 S3P probably benign Het
Glp1r G T 17: 30,918,975 E127* probably null Het
Gnmt G T 17: 46,728,984 H56Q probably benign Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hsd3b1 G A 3: 98,856,143 T48I probably benign Het
Kmt2c A T 5: 25,310,212 C2878S probably benign Het
Loxhd1 A G 18: 77,399,089 Y1290C probably damaging Het
Mkln1 A G 6: 31,426,772 Y76C probably damaging Het
Mri1 C A 8: 84,256,406 A129S probably benign Het
Mroh2b A T 15: 4,947,925 H1253L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mthfsd C T 8: 121,105,765 V63I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nbea A G 3: 55,643,784 V2653A probably benign Het
Nckap5 A T 1: 125,914,735 probably benign Het
Notch4 G A 17: 34,583,833 V1378M probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rasl12 A G 9: 65,398,584 K7R probably null Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Shroom3 A G 5: 92,940,999 H536R probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Tbc1d5 A C 17: 50,782,341 S604A probably damaging Het
Tcp11l1 A T 2: 104,684,222 V400E probably damaging Het
Tom1l2 G T 11: 60,352,815 probably benign Het
Ttc28 AC A 5: 111,224,058 probably null Het
Txndc15 A G 13: 55,718,164 D147G possibly damaging Het
Other mutations in Olfr643
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr643 APN 7 104059416 missense probably damaging 1.00
IGL00958:Olfr643 APN 7 104059413 missense probably benign 0.14
IGL02319:Olfr643 APN 7 104058933 missense probably damaging 1.00
IGL03184:Olfr643 APN 7 104058847 missense probably damaging 0.97
R0254:Olfr643 UTSW 7 104059521 missense probably benign 0.00
R0850:Olfr643 UTSW 7 104059045 missense probably benign
R1443:Olfr643 UTSW 7 104058723 missense probably damaging 1.00
R1544:Olfr643 UTSW 7 104059224 missense probably damaging 0.99
R1669:Olfr643 UTSW 7 104059309 missense probably benign 0.32
R1990:Olfr643 UTSW 7 104059128 missense possibly damaging 0.96
R2207:Olfr643 UTSW 7 104059405 missense probably damaging 1.00
R4719:Olfr643 UTSW 7 104058733 missense probably damaging 1.00
R5519:Olfr643 UTSW 7 104059297 nonsense probably null
Z1088:Olfr643 UTSW 7 104059316 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAGCACATTAGCCTTGCAGAAG -3'
(R):5'- GCAATGCCCTGATCCTGTTC -3'

Sequencing Primer
(F):5'- CAACCTCTTCAGAAGGAAAGGTAATG -3'
(R):5'- CTGATCCTGTTCATCATCAAGGAGG -3'
Posted On2015-07-21