Incidental Mutation 'R4456:Mri1'
ID329190
Institutional Source Beutler Lab
Gene Symbol Mri1
Ensembl Gene ENSMUSG00000004996
Gene Namemethylthioribose-1-phosphate isomerase 1
Synonyms2410018C20Rik
MMRRC Submission 041716-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R4456 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84249906-84257326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84256406 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 129 (A129S)
Ref Sequence ENSEMBL: ENSMUSP00000122623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005120] [ENSMUST00000098578] [ENSMUST00000126435] [ENSMUST00000172320]
Predicted Effect probably benign
Transcript: ENSMUST00000005120
SMART Domains Protein: ENSMUSP00000005120
Gene: ENSMUSG00000004994

DomainStartEndE-ValueType
Pfam:DUF572 1 198 1.7e-85 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000005122
AA Change: A124S
SMART Domains Protein: ENSMUSP00000005122
Gene: ENSMUSG00000004996
AA Change: A124S

DomainStartEndE-ValueType
Pfam:IF-2B 40 152 9.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098578
SMART Domains Protein: ENSMUSP00000096177
Gene: ENSMUSG00000004994

DomainStartEndE-ValueType
Pfam:DUF572 1 384 1.4e-101 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000125498
AA Change: A3S
SMART Domains Protein: ENSMUSP00000117115
Gene: ENSMUSG00000004996
AA Change: A3S

DomainStartEndE-ValueType
Pfam:IF-2B 2 226 5.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126435
AA Change: A129S

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122623
Gene: ENSMUSG00000004996
AA Change: A129S

DomainStartEndE-ValueType
Pfam:IF-2B 44 346 4.8e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166285
Predicted Effect probably benign
Transcript: ENSMUST00000172320
SMART Domains Protein: ENSMUSP00000128605
Gene: ENSMUSG00000004994

DomainStartEndE-ValueType
Pfam:DUF572 1 68 1.4e-31 PFAM
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This enzyme functions in the methionine salvage pathway by catalyzing the interconversion of methylthioribose-1-phosphate and methythioribulose-1-phosphate. Elevated expression of the encoded protein is associated with metastatic melanoma and this protein promotes melanoma cell invasion independent of its enzymatic activity. Mutations in this gene may be associated with vanishing white matter disease (VMWD). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,942,245 F1210L probably benign Het
Amfr C T 8: 93,984,940 A323T possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cdc42ep1 A G 15: 78,849,891 E397G possibly damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Dnmt1 T C 9: 20,909,842 T1250A probably damaging Het
Dst A T 1: 34,190,719 K2642N probably benign Het
Emcn A T 3: 137,379,847 K69* probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fbxo38 G T 18: 62,526,249 R326S probably damaging Het
Fcer1g A G 1: 171,234,239 S3P probably benign Het
Glp1r G T 17: 30,918,975 E127* probably null Het
Gnmt G T 17: 46,728,984 H56Q probably benign Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hsd3b1 G A 3: 98,856,143 T48I probably benign Het
Kmt2c A T 5: 25,310,212 C2878S probably benign Het
Loxhd1 A G 18: 77,399,089 Y1290C probably damaging Het
Mkln1 A G 6: 31,426,772 Y76C probably damaging Het
Mroh2b A T 15: 4,947,925 H1253L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mthfsd C T 8: 121,105,765 V63I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nbea A G 3: 55,643,784 V2653A probably benign Het
Nckap5 A T 1: 125,914,735 probably benign Het
Notch4 G A 17: 34,583,833 V1378M probably damaging Het
Olfr643 A G 7: 104,059,300 S101P possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rasl12 A G 9: 65,398,584 K7R probably null Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Shroom3 A G 5: 92,940,999 H536R probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Tbc1d5 A C 17: 50,782,341 S604A probably damaging Het
Tcp11l1 A T 2: 104,684,222 V400E probably damaging Het
Tom1l2 G T 11: 60,352,815 probably benign Het
Ttc28 AC A 5: 111,224,058 probably null Het
Txndc15 A G 13: 55,718,164 D147G possibly damaging Het
Other mutations in Mri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mri1 APN 8 84251648 missense probably damaging 1.00
IGL02226:Mri1 APN 8 84256295 missense probably damaging 1.00
IGL02642:Mri1 APN 8 84257073 missense probably damaging 1.00
IGL03365:Mri1 APN 8 84251633 missense possibly damaging 0.52
R1722:Mri1 UTSW 8 84253925 missense possibly damaging 0.66
R4372:Mri1 UTSW 8 84253925 missense probably benign 0.07
R5943:Mri1 UTSW 8 84254319 nonsense probably null
R7084:Mri1 UTSW 8 84251079 missense
R7142:Mri1 UTSW 8 84257124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCTAACAATTGAAGGTGC -3'
(R):5'- TGACGTCATCATCACAGAGG -3'

Sequencing Primer
(F):5'- GTGCCTCCTCACCTAACG -3'
(R):5'- TCACAGAGGTAAAGGGTTTCCTCC -3'
Posted On2015-07-21