Incidental Mutation 'R4456:Amfr'
ID329191
Institutional Source Beutler Lab
Gene Symbol Amfr
Ensembl Gene ENSMUSG00000031751
Gene Nameautocrine motility factor receptor
Synonymsgp78
MMRRC Submission 041716-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R4456 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93971588-94012842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93984940 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 323 (A323T)
Ref Sequence ENSEMBL: ENSMUSP00000052258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053766]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053766
AA Change: A323T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052258
Gene: ENSMUSG00000031751
AA Change: A323T

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 141 158 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
RING 337 374 1.14e-8 SMART
CUE 452 493 3.3e-11 SMART
PDB:4LAD|B 571 596 2e-7 PDB
low complexity region 620 637 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a glycosylated transmembrane receptor. Its ligand, autocrine motility factor, is a tumor motility-stimulating protein secreted by tumor cells. The encoded receptor is also a member of the E3 ubiquitin ligase family of proteins. It catalyzes ubiquitination and endoplasmic reticulum-associated degradation of specific proteins. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice for a gene-trapped null allele are obese and develop liver steatosis and/or hepatic inflammation resembling nonalcoholic steatohepatitis. Some mice develop liver tumors. Mice homozygous for another knock-out allele exhibit normal HMGCR turnover in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,942,245 F1210L probably benign Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cdc42ep1 A G 15: 78,849,891 E397G possibly damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Dnmt1 T C 9: 20,909,842 T1250A probably damaging Het
Dst A T 1: 34,190,719 K2642N probably benign Het
Emcn A T 3: 137,379,847 K69* probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fbxo38 G T 18: 62,526,249 R326S probably damaging Het
Fcer1g A G 1: 171,234,239 S3P probably benign Het
Glp1r G T 17: 30,918,975 E127* probably null Het
Gnmt G T 17: 46,728,984 H56Q probably benign Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hsd3b1 G A 3: 98,856,143 T48I probably benign Het
Kmt2c A T 5: 25,310,212 C2878S probably benign Het
Loxhd1 A G 18: 77,399,089 Y1290C probably damaging Het
Mkln1 A G 6: 31,426,772 Y76C probably damaging Het
Mri1 C A 8: 84,256,406 A129S probably benign Het
Mroh2b A T 15: 4,947,925 H1253L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mthfsd C T 8: 121,105,765 V63I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nbea A G 3: 55,643,784 V2653A probably benign Het
Nckap5 A T 1: 125,914,735 probably benign Het
Notch4 G A 17: 34,583,833 V1378M probably damaging Het
Olfr643 A G 7: 104,059,300 S101P possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rasl12 A G 9: 65,398,584 K7R probably null Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Shroom3 A G 5: 92,940,999 H536R probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Tbc1d5 A C 17: 50,782,341 S604A probably damaging Het
Tcp11l1 A T 2: 104,684,222 V400E probably damaging Het
Tom1l2 G T 11: 60,352,815 probably benign Het
Ttc28 AC A 5: 111,224,058 probably null Het
Txndc15 A G 13: 55,718,164 D147G possibly damaging Het
Other mutations in Amfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Amfr APN 8 93987508 critical splice acceptor site probably null
IGL02169:Amfr APN 8 94005230 splice site probably null
IGL03218:Amfr APN 8 94000336 missense probably damaging 0.97
FR4449:Amfr UTSW 8 94005159 missense probably damaging 1.00
FR4737:Amfr UTSW 8 94005159 missense probably damaging 1.00
FR4976:Amfr UTSW 8 94012292 unclassified probably benign
R0344:Amfr UTSW 8 93987370 splice site probably null
R0532:Amfr UTSW 8 93999108 missense probably damaging 1.00
R1056:Amfr UTSW 8 93985469 missense probably benign 0.27
R1295:Amfr UTSW 8 93974804 missense probably benign 0.26
R1386:Amfr UTSW 8 93985399 missense possibly damaging 0.58
R1450:Amfr UTSW 8 93987747 missense probably benign 0.45
R1613:Amfr UTSW 8 93999226 missense probably benign 0.00
R1703:Amfr UTSW 8 93974243 missense probably benign
R2857:Amfr UTSW 8 94005214 missense probably damaging 1.00
R2858:Amfr UTSW 8 94005214 missense probably damaging 1.00
R2859:Amfr UTSW 8 94005214 missense probably damaging 1.00
R3109:Amfr UTSW 8 94000306 missense probably damaging 1.00
R3708:Amfr UTSW 8 93983320 missense probably benign 0.05
R4600:Amfr UTSW 8 93974221 missense probably damaging 0.99
R4952:Amfr UTSW 8 93973159 unclassified probably benign
R5261:Amfr UTSW 8 93976170 critical splice acceptor site probably null
R5391:Amfr UTSW 8 93976048 missense probably damaging 1.00
R5788:Amfr UTSW 8 94000314 missense probably damaging 1.00
R6238:Amfr UTSW 8 94000364 missense probably damaging 1.00
R6584:Amfr UTSW 8 93974155 missense probably benign 0.00
R6795:Amfr UTSW 8 94000333 missense probably benign 0.09
R6955:Amfr UTSW 8 94000376 missense probably damaging 1.00
R6978:Amfr UTSW 8 94000387 missense probably damaging 0.99
R7097:Amfr UTSW 8 94012009 missense probably benign 0.00
R7224:Amfr UTSW 8 93984856 missense probably damaging 1.00
R7260:Amfr UTSW 8 93976148 missense possibly damaging 0.80
R7289:Amfr UTSW 8 93999126 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCTCTCGTGCTGGGAATATG -3'
(R):5'- TCTGCTTGTGGACATGGCTC -3'

Sequencing Primer
(F):5'- CTGGGAATATGTTCAAAGCCACTG -3'
(R):5'- GTGGACATGGCTCTCTCACTG -3'
Posted On2015-07-21