Incidental Mutation 'R4456:Cdkn2d'
ID329194
Institutional Source Beutler Lab
Gene Symbol Cdkn2d
Ensembl Gene ENSMUSG00000096472
Gene Namecyclin dependent kinase inhibitor 2D
Synonymsp19, p19INK4d, INK4d, INK4d
MMRRC Submission 041716-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4456 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21288410-21291407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 21290889 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 21 (V21L)
Ref Sequence ENSEMBL: ENSMUSP00000150701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003397] [ENSMUST00000038671] [ENSMUST00000086374] [ENSMUST00000115433] [ENSMUST00000184326] [ENSMUST00000213407] [ENSMUST00000213762] [ENSMUST00000215619]
Predicted Effect probably benign
Transcript: ENSMUST00000003397
SMART Domains Protein: ENSMUSP00000003397
Gene: ENSMUSG00000003309

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.3e-9 PFAM
Pfam:Adap_comp_sub 157 422 7.3e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038671
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000086374
AA Change: V21L
SMART Domains Protein: ENSMUSP00000083561
Gene: ENSMUSG00000096472
AA Change: V21L

DomainStartEndE-ValueType
ANK 41 69 1.01e2 SMART
ANK 73 102 1.73e-4 SMART
ANK 106 134 8.89e1 SMART
Blast:ANK 138 166 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115433
SMART Domains Protein: ENSMUSP00000111093
Gene: ENSMUSG00000003309

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.4e-9 PFAM
Pfam:Adap_comp_sub 157 424 4.7e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183912
Predicted Effect probably benign
Transcript: ENSMUST00000184326
SMART Domains Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
Pfam:Kri1 207 317 4.4e-27 PFAM
Pfam:Kri1_C 381 472 3.6e-36 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184615
Predicted Effect probably benign
Transcript: ENSMUST00000213407
AA Change: V21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213762
Predicted Effect probably benign
Transcript: ENSMUST00000215619
AA Change: V21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to form a stable complex with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. The abundance of the transcript of this gene was found to oscillate in a cell-cycle dependent manner with the lowest expression at mid G1 and a maximal expression during S phase. The negative regulation of the cell cycle involved in this protein was shown to participate in repressing neuronal proliferation, as well as spermatogenesis. Two alternatively spliced variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both female and male homozygous null mice are fertile in spite of testicular atrophy and increased male germ cell apoptosis due to delayed meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,942,245 F1210L probably benign Het
Amfr C T 8: 93,984,940 A323T possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cdc42ep1 A G 15: 78,849,891 E397G possibly damaging Het
Dnmt1 T C 9: 20,909,842 T1250A probably damaging Het
Dst A T 1: 34,190,719 K2642N probably benign Het
Emcn A T 3: 137,379,847 K69* probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fbxo38 G T 18: 62,526,249 R326S probably damaging Het
Fcer1g A G 1: 171,234,239 S3P probably benign Het
Glp1r G T 17: 30,918,975 E127* probably null Het
Gnmt G T 17: 46,728,984 H56Q probably benign Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hsd3b1 G A 3: 98,856,143 T48I probably benign Het
Kmt2c A T 5: 25,310,212 C2878S probably benign Het
Loxhd1 A G 18: 77,399,089 Y1290C probably damaging Het
Mkln1 A G 6: 31,426,772 Y76C probably damaging Het
Mri1 C A 8: 84,256,406 A129S probably benign Het
Mroh2b A T 15: 4,947,925 H1253L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mthfsd C T 8: 121,105,765 V63I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nbea A G 3: 55,643,784 V2653A probably benign Het
Nckap5 A T 1: 125,914,735 probably benign Het
Notch4 G A 17: 34,583,833 V1378M probably damaging Het
Olfr643 A G 7: 104,059,300 S101P possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rasl12 A G 9: 65,398,584 K7R probably null Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Shroom3 A G 5: 92,940,999 H536R probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Tbc1d5 A C 17: 50,782,341 S604A probably damaging Het
Tcp11l1 A T 2: 104,684,222 V400E probably damaging Het
Tom1l2 G T 11: 60,352,815 probably benign Het
Ttc28 AC A 5: 111,224,058 probably null Het
Txndc15 A G 13: 55,718,164 D147G possibly damaging Het
Other mutations in Cdkn2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02516:Cdkn2d APN 9 21289143 missense probably benign 0.04
R0238:Cdkn2d UTSW 9 21290992 start gained probably benign
R0238:Cdkn2d UTSW 9 21290992 start gained probably benign
R2064:Cdkn2d UTSW 9 21290879 missense probably damaging 1.00
R4454:Cdkn2d UTSW 9 21290889 missense probably benign
R4455:Cdkn2d UTSW 9 21290889 missense probably benign
R4457:Cdkn2d UTSW 9 21290889 missense probably benign
R4458:Cdkn2d UTSW 9 21290889 missense probably benign
R4462:Cdkn2d UTSW 9 21290889 missense probably benign
R4463:Cdkn2d UTSW 9 21290889 missense probably benign
R4735:Cdkn2d UTSW 9 21290889 missense probably benign
R4854:Cdkn2d UTSW 9 21290927 missense probably benign
R5493:Cdkn2d UTSW 9 21289007 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTAGACAAGAGCTGAAAAGCCATC -3'
(R):5'- TCATAGAGTTGGCCCTGGTG -3'

Sequencing Primer
(F):5'- GAGCTGAAAAGCCATCCCCTC -3'
(R):5'- TGGCACCGCAGTCCCTAG -3'
Posted On2015-07-21