Incidental Mutation 'R4456:Tbc1d5'
ID329209
Institutional Source Beutler Lab
Gene Symbol Tbc1d5
Ensembl Gene ENSMUSG00000023923
Gene NameTBC1 domain family, member 5
Synonyms1600014N05Rik
MMRRC Submission 041716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R4456 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location50733124-51179352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 50782341 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 604 (S604A)
Ref Sequence ENSEMBL: ENSMUSP00000153172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024717] [ENSMUST00000224528]
Predicted Effect probably damaging
Transcript: ENSMUST00000024717
AA Change: S582A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024717
Gene: ENSMUSG00000023923
AA Change: S582A

DomainStartEndE-ValueType
TBC 78 384 5.56e-86 SMART
low complexity region 475 492 N/A INTRINSIC
SCOP:d1lsha3 511 546 1e-3 SMART
low complexity region 556 568 N/A INTRINSIC
low complexity region 783 802 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224528
AA Change: S604A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224977
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,942,245 F1210L probably benign Het
Amfr C T 8: 93,984,940 A323T possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cdc42ep1 A G 15: 78,849,891 E397G possibly damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Dnmt1 T C 9: 20,909,842 T1250A probably damaging Het
Dst A T 1: 34,190,719 K2642N probably benign Het
Emcn A T 3: 137,379,847 K69* probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fbxo38 G T 18: 62,526,249 R326S probably damaging Het
Fcer1g A G 1: 171,234,239 S3P probably benign Het
Glp1r G T 17: 30,918,975 E127* probably null Het
Gnmt G T 17: 46,728,984 H56Q probably benign Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hsd3b1 G A 3: 98,856,143 T48I probably benign Het
Kmt2c A T 5: 25,310,212 C2878S probably benign Het
Loxhd1 A G 18: 77,399,089 Y1290C probably damaging Het
Mkln1 A G 6: 31,426,772 Y76C probably damaging Het
Mri1 C A 8: 84,256,406 A129S probably benign Het
Mroh2b A T 15: 4,947,925 H1253L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mthfsd C T 8: 121,105,765 V63I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nbea A G 3: 55,643,784 V2653A probably benign Het
Nckap5 A T 1: 125,914,735 probably benign Het
Notch4 G A 17: 34,583,833 V1378M probably damaging Het
Olfr643 A G 7: 104,059,300 S101P possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rasl12 A G 9: 65,398,584 K7R probably null Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Shroom3 A G 5: 92,940,999 H536R probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Tcp11l1 A T 2: 104,684,222 V400E probably damaging Het
Tom1l2 G T 11: 60,352,815 probably benign Het
Ttc28 AC A 5: 111,224,058 probably null Het
Txndc15 A G 13: 55,718,164 D147G possibly damaging Het
Other mutations in Tbc1d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tbc1d5 APN 17 50813798 missense possibly damaging 0.52
IGL01370:Tbc1d5 APN 17 50966727 missense probably benign 0.18
IGL01625:Tbc1d5 APN 17 50917573 missense probably benign 0.27
IGL01935:Tbc1d5 APN 17 50963765 splice site probably benign
IGL02229:Tbc1d5 APN 17 50852600 missense probably damaging 1.00
IGL02811:Tbc1d5 APN 17 50800121 missense probably damaging 0.99
IGL03192:Tbc1d5 APN 17 50984681 splice site probably benign
FR4976:Tbc1d5 UTSW 17 50799931 missense probably benign
FR4976:Tbc1d5 UTSW 17 50799943 missense probably benign 0.01
IGL02796:Tbc1d5 UTSW 17 50966624 missense probably damaging 1.00
R0153:Tbc1d5 UTSW 17 50984687 splice site probably benign
R0326:Tbc1d5 UTSW 17 50966736 missense probably damaging 1.00
R0417:Tbc1d5 UTSW 17 50756705 missense probably benign 0.18
R0481:Tbc1d5 UTSW 17 50919051 missense probably damaging 0.98
R1143:Tbc1d5 UTSW 17 50742059 nonsense probably null
R1533:Tbc1d5 UTSW 17 50920575 missense possibly damaging 0.89
R1543:Tbc1d5 UTSW 17 50935532 missense probably benign 0.32
R2888:Tbc1d5 UTSW 17 50935549 missense probably damaging 1.00
R3153:Tbc1d5 UTSW 17 50968236 missense probably damaging 1.00
R3430:Tbc1d5 UTSW 17 50800128 missense probably damaging 1.00
R3898:Tbc1d5 UTSW 17 50963744 missense probably damaging 0.98
R4116:Tbc1d5 UTSW 17 50920587 missense probably damaging 1.00
R4352:Tbc1d5 UTSW 17 50782401 missense probably damaging 0.98
R4648:Tbc1d5 UTSW 17 50736223 missense probably benign
R4711:Tbc1d5 UTSW 17 50935509 missense probably damaging 0.98
R4754:Tbc1d5 UTSW 17 50800165 missense probably benign 0.03
R5303:Tbc1d5 UTSW 17 50736200 missense probably benign 0.00
R5360:Tbc1d5 UTSW 17 50984632 missense probably benign 0.26
R5443:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5444:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5611:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5658:Tbc1d5 UTSW 17 50813841 missense probably benign 0.18
R5701:Tbc1d5 UTSW 17 50799955 small deletion probably benign
R5921:Tbc1d5 UTSW 17 50963693 missense probably damaging 1.00
R6280:Tbc1d5 UTSW 17 50782310 missense probably benign 0.01
R6628:Tbc1d5 UTSW 17 50736208 missense probably benign
R6705:Tbc1d5 UTSW 17 51025175 start gained probably benign
R6990:Tbc1d5 UTSW 17 50968232 missense probably benign 0.19
Z1088:Tbc1d5 UTSW 17 50963696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCCAGGTAACAAAGATCGAG -3'
(R):5'- GAAAGTGACTTCCTAGCTAATCATG -3'

Sequencing Primer
(F):5'- AGATCGAGGCCTTAAAATATTGC -3'
(R):5'- TGACTCAGTGATGATCTGG -3'
Posted On2015-07-21