Incidental Mutation 'R4467:Dmtf1'
ID329227
Institutional Source Beutler Lab
Gene Symbol Dmtf1
Ensembl Gene ENSMUSG00000042508
Gene Namecyclin D binding myb-like transcription factor 1
SynonymsDmp1
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location9118801-9161776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9136085 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 167 (N167S)
Ref Sequence ENSEMBL: ENSMUSP00000139164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071921] [ENSMUST00000095017] [ENSMUST00000183448] [ENSMUST00000183525] [ENSMUST00000183973] [ENSMUST00000184120] [ENSMUST00000184159] [ENSMUST00000184372] [ENSMUST00000184401] [ENSMUST00000184620] [ENSMUST00000184888] [ENSMUST00000196029]
Predicted Effect probably damaging
Transcript: ENSMUST00000071921
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071815
Gene: ENSMUSG00000042508
AA Change: N167S

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 522 542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095017
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092627
Gene: ENSMUSG00000042508
AA Change: N167S

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 452 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183448
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139042
Gene: ENSMUSG00000042508
AA Change: N167S

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000183525
AA Change: N167S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139339
Gene: ENSMUSG00000042508
AA Change: N167S

DomainStartEndE-ValueType
Blast:SANT 152 191 2e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183792
Predicted Effect probably damaging
Transcript: ENSMUST00000183973
AA Change: N79S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508
AA Change: N79S

DomainStartEndE-ValueType
SANT 135 182 2.52e-10 SMART
SANT 184 243 6.05e-13 SMART
SANT 247 302 5.36e-5 SMART
low complexity region 434 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184120
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138861
Gene: ENSMUSG00000042508
AA Change: N167S

DomainStartEndE-ValueType
Blast:SANT 152 226 6e-48 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000184159
AA Change: N126S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139231
Gene: ENSMUSG00000042508
AA Change: N126S

DomainStartEndE-ValueType
SANT 182 229 2.52e-10 SMART
SANT 231 290 6.05e-13 SMART
SANT 294 349 5.36e-5 SMART
low complexity region 391 406 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184372
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139191
Gene: ENSMUSG00000042508
AA Change: N167S

DomainStartEndE-ValueType
Blast:SANT 152 226 7e-49 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000184401
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139281
Gene: ENSMUSG00000042508
AA Change: N167S

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000184620
AA Change: N126S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138816
Gene: ENSMUSG00000042508
AA Change: N126S

DomainStartEndE-ValueType
Blast:SANT 111 185 4e-48 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000184888
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139164
Gene: ENSMUSG00000042508
AA Change: N167S

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184947
Predicted Effect probably benign
Transcript: ENSMUST00000196029
Meta Mutation Damage Score 0.532 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ARF and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. It also activates the transcription of aminopeptidase N and may play a role in hematopoietic cell differentiation. The transcriptional activity of this protein is regulated by binding of D-cyclins. This gene is hemizygously deleted in approximately 40% of human non-small-cell lung cancer and is a potential prognostic and gene-therapy target for non-small-cell lung cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutants exhibit partial postnatal lethality, small size, and decreased thymocyte number. Some mutants exhibit seizures and/or obstructive uropathy. Males have dilated seminal vesicles. Mice develop spontaneous tumors in the second year of life, and are susceptible to induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Dmtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmtf1 APN 5 9136070 missense probably damaging 1.00
IGL02323:Dmtf1 APN 5 9120056 missense possibly damaging 0.96
IGL02652:Dmtf1 APN 5 9121853 missense probably benign 0.01
IGL02680:Dmtf1 APN 5 9130381 missense probably benign 0.01
IGL02732:Dmtf1 APN 5 9136098 missense possibly damaging 0.77
IGL03002:Dmtf1 APN 5 9140474 missense probably damaging 1.00
IGL03074:Dmtf1 APN 5 9124435 intron probably benign
R0149:Dmtf1 UTSW 5 9132571 missense probably damaging 1.00
R0466:Dmtf1 UTSW 5 9132454 critical splice donor site probably null
R0825:Dmtf1 UTSW 5 9130388 missense probably damaging 1.00
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0974:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R1068:Dmtf1 UTSW 5 9136109 missense probably damaging 1.00
R1293:Dmtf1 UTSW 5 9140383 splice site probably null
R1478:Dmtf1 UTSW 5 9121404 missense possibly damaging 0.93
R1515:Dmtf1 UTSW 5 9140384 critical splice donor site probably null
R1861:Dmtf1 UTSW 5 9120347 splice site probably null
R1898:Dmtf1 UTSW 5 9128091 missense probably damaging 0.99
R1970:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R1971:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R2519:Dmtf1 UTSW 5 9129323 missense possibly damaging 0.71
R3053:Dmtf1 UTSW 5 9129316 missense probably damaging 0.99
R3195:Dmtf1 UTSW 5 9132454 intron probably benign
R4490:Dmtf1 UTSW 5 9140379 intron probably benign
R4491:Dmtf1 UTSW 5 9140379 intron probably benign
R5007:Dmtf1 UTSW 5 9122439 unclassified probably benign
R5173:Dmtf1 UTSW 5 9140356 intron probably benign
R5184:Dmtf1 UTSW 5 9126641 missense probably benign 0.36
R5646:Dmtf1 UTSW 5 9124515 missense possibly damaging 0.62
R5958:Dmtf1 UTSW 5 9122415 unclassified probably benign
R5977:Dmtf1 UTSW 5 9140451 missense probably damaging 0.99
R6184:Dmtf1 UTSW 5 9126656 missense probably benign
R6887:Dmtf1 UTSW 5 9137149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACCTATGATCACAGTAGCAC -3'
(R):5'- TAGCCTGGTTCTCTTCCTAGGG -3'

Sequencing Primer
(F):5'- CTATGATCACAGTAGCACAAAAGG -3'
(R):5'- GGTTCTCTTCCTAGGGACACAC -3'
Posted On2015-07-21