Incidental Mutation 'R4467:Tctn2'
ID 329230
Institutional Source Beutler Lab
Gene Symbol Tctn2
Ensembl Gene ENSMUSG00000029386
Gene Name tectonic family member 2
Synonyms Tect2, 4432405B04Rik
MMRRC Submission 041724-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R4467 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 124736812-124765803 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) T to C at 124758252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100706
SMART Domains Protein: ENSMUSP00000098272
Gene: ENSMUSG00000029386

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:DUF1619 171 442 6.8e-75 PFAM
low complexity region 669 681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130912
SMART Domains Protein: ENSMUSP00000114298
Gene: ENSMUSG00000029386

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:DUF1619 171 442 1.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185820
Meta Mutation Damage Score 0.5949 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein that belongs to the tectonic family. Studies in mice suggest that this protein may be involved in hedgehog signaling, and essential for ciliogenesis. Mutations in this gene are associated with Meckel syndrome type 8. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit open neural tubes, exencephaly, micropthalmia, cleft palate, preaxial polydactyly, ventricular septal defect, sight-sided stomach, absent floor plate, and cilia defects. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 64,056,182 (GRCm39) probably benign Het
Atg4a-ps A G 3: 103,553,171 (GRCm39) Y57H probably damaging Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Bms1 G A 6: 118,360,808 (GRCm39) T1220I probably damaging Het
Brat1 T C 5: 140,690,826 (GRCm39) probably benign Het
Cds2 T A 2: 132,136,366 (GRCm39) Y39* probably null Het
Chrnd T A 1: 87,125,099 (GRCm39) L384Q probably damaging Het
Cpa3 A T 3: 20,282,981 (GRCm39) Y155* probably null Het
Crlf1 G A 8: 70,953,606 (GRCm39) W260* probably null Het
Cux1 C G 5: 136,341,576 (GRCm39) E605D probably damaging Het
Cylc2 C G 4: 51,229,651 (GRCm39) T331R unknown Het
Dmtf1 T C 5: 9,186,085 (GRCm39) N167S probably damaging Het
Dnaaf9 A G 2: 130,609,567 (GRCm39) I372T probably damaging Het
Dnai7 A T 6: 145,128,944 (GRCm39) probably null Het
Dtx2 T A 5: 136,040,930 (GRCm39) W112R probably damaging Het
Elf3 A G 1: 135,184,582 (GRCm39) I138T probably damaging Het
F11 T A 8: 45,694,511 (GRCm39) I617F probably damaging Het
Fdps A T 3: 89,008,093 (GRCm39) D8E possibly damaging Het
Fzd10 C A 5: 128,678,340 (GRCm39) T20K probably benign Het
Gm9978 T A 10: 78,322,750 (GRCm39) noncoding transcript Het
Gpr158 T A 2: 21,831,810 (GRCm39) M970K probably damaging Het
Has1 C T 17: 18,064,257 (GRCm39) V461M probably benign Het
Hdac3 C T 18: 38,085,566 (GRCm39) G80D probably benign Het
Klk12 A T 7: 43,422,807 (GRCm39) R245W probably damaging Het
Lamp5 A G 2: 135,900,940 (GRCm39) I47V probably damaging Het
Or6c1b T C 10: 129,272,933 (GRCm39) I84T probably benign Het
Ovgp1 A G 3: 105,885,027 (GRCm39) D122G probably benign Het
Piezo1 T C 8: 123,213,135 (GRCm39) E1875G probably benign Het
Pih1d1 A G 7: 44,807,921 (GRCm39) M132V possibly damaging Het
Pon2 C T 6: 5,267,021 (GRCm39) A241T probably benign Het
Prkce A G 17: 86,927,339 (GRCm39) I538V possibly damaging Het
Rab36 C T 10: 74,887,875 (GRCm39) R249* probably null Het
Rps6kl1 C T 12: 85,194,582 (GRCm39) A110T probably damaging Het
Rsad1 T C 11: 94,435,356 (GRCm39) T244A probably benign Het
Slc22a7 T C 17: 46,743,436 (GRCm39) I532V probably benign Het
Slc2a7 T C 4: 150,247,731 (GRCm39) V377A possibly damaging Het
Slx4 A G 16: 3,806,919 (GRCm39) V508A possibly damaging Het
Stag2 A G X: 41,322,749 (GRCm39) S400G probably benign Het
Stat6 T G 10: 127,487,097 (GRCm39) I201M probably damaging Het
Stim2 T C 5: 54,273,536 (GRCm39) probably null Het
Tbc1d9 A G 8: 83,937,107 (GRCm39) Y63C probably damaging Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Ubr5 T A 15: 38,004,580 (GRCm39) T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 (GRCm39) I550N probably damaging Het
Uty A G Y: 1,158,372 (GRCm39) V557A possibly damaging Het
Vmn1r54 T C 6: 90,246,253 (GRCm39) S56P probably damaging Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Other mutations in Tctn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Tctn2 APN 5 124,754,591 (GRCm39) exon noncoding transcript
IGL02154:Tctn2 APN 5 124,746,624 (GRCm39) exon noncoding transcript
IGL02447:Tctn2 APN 5 124,753,316 (GRCm39) exon noncoding transcript
3-1:Tctn2 UTSW 5 124,753,294 (GRCm39) exon noncoding transcript
R0101:Tctn2 UTSW 5 124,753,357 (GRCm39) splice site noncoding transcript
R0101:Tctn2 UTSW 5 124,753,357 (GRCm39) splice site noncoding transcript
R1481:Tctn2 UTSW 5 124,745,826 (GRCm39) exon noncoding transcript
R1764:Tctn2 UTSW 5 124,757,094 (GRCm39) splice site noncoding transcript
R1865:Tctn2 UTSW 5 124,757,143 (GRCm39) exon noncoding transcript
R5390:Tctn2 UTSW 5 124,762,400 (GRCm39) unclassified probably benign
R5884:Tctn2 UTSW 5 124,741,895 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GATTAGAGTTTTCAGAAGCTAGAAACT -3'
(R):5'- GACCACTCACAATGCGGGAA -3'

Sequencing Primer
(F):5'- TCAACAATTCAGGCCAGTCTGGG -3'
(R):5'- TCACAATGCGGGAAAGTTCATC -3'
Posted On 2015-07-21