Incidental Mutation 'R4467:Pon2'
ID329235
Institutional Source Beutler Lab
Gene Symbol Pon2
Ensembl Gene ENSMUSG00000032667
Gene Nameparaoxonase 2
Synonyms
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location5264147-5298455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5267021 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 241 (A241T)
Ref Sequence ENSEMBL: ENSMUSP00000062670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057792]
Predicted Effect probably benign
Transcript: ENSMUST00000057792
AA Change: A241T

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062670
Gene: ENSMUSG00000032667
AA Change: A241T

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:SGL 107 303 1e-12 PFAM
Pfam:Arylesterase 167 252 3.9e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123838
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed an atherogenic diet, mice homozygous for a gene trapped allele show markedly lower VLDL/LDL cholesterol and serum apoB levels, higher cellular oxidative stress, enhanced macrophage immunoreactivity and LDL-induced monocyte chemotaxis, and largeratheromatous lesions than wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Pon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Pon2 APN 6 5272331 missense probably damaging 1.00
IGL02683:Pon2 APN 6 5269062 missense probably damaging 1.00
IGL03240:Pon2 APN 6 5265316 utr 3 prime probably benign
R0102:Pon2 UTSW 6 5289091 splice site probably benign
R0102:Pon2 UTSW 6 5289091 splice site probably benign
R0360:Pon2 UTSW 6 5266156 nonsense probably null
R0364:Pon2 UTSW 6 5266156 nonsense probably null
R0402:Pon2 UTSW 6 5272410 nonsense probably null
R0494:Pon2 UTSW 6 5267059 splice site probably benign
R1593:Pon2 UTSW 6 5273003 missense probably benign
R3001:Pon2 UTSW 6 5268976 critical splice donor site probably null
R3002:Pon2 UTSW 6 5268976 critical splice donor site probably null
R3236:Pon2 UTSW 6 5266986 missense possibly damaging 0.59
R4911:Pon2 UTSW 6 5269029 missense possibly damaging 0.93
R5237:Pon2 UTSW 6 5265455 missense probably benign
R6025:Pon2 UTSW 6 5289057 missense probably benign 0.40
R6313:Pon2 UTSW 6 5272421 missense probably damaging 1.00
R6737:Pon2 UTSW 6 5266183 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGACATCTAAGAACACAGACTGGC -3'
(R):5'- ACTCTTGGTTATTTCAGCGGC -3'

Sequencing Primer
(F):5'- CAGACTGGCTGCCTTGTCTG -3'
(R):5'- TCAGCGGCAAATATTATGAACTTC -3'
Posted On2015-07-21