Incidental Mutation 'R4467:Bag4'
ID329241
Institutional Source Beutler Lab
Gene Symbol Bag4
Ensembl Gene ENSMUSG00000037316
Gene NameBCL2-associated athanogene 4
Synonyms
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25764538-25785287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25769488 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 228 (A228T)
Ref Sequence ENSEMBL: ENSMUSP00000044725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038498]
Predicted Effect probably benign
Transcript: ENSMUST00000038498
AA Change: A228T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044725
Gene: ENSMUSG00000037316
AA Change: A228T

DomainStartEndE-ValueType
low complexity region 5 49 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
low complexity region 276 301 N/A INTRINSIC
BAG 379 456 3.66e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167899
SMART Domains Protein: ENSMUSP00000130277
Gene: ENSMUSG00000091514

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210103
Meta Mutation Damage Score 0.0436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. This protein was found to be associated with the death domain of tumor necrosis factor receptor type 1 (TNF-R1) and death receptor-3 (DR3), and thereby negatively regulates downstream cell death signaling. The regulatory role of this protein in cell death was demonstrated in epithelial cells which undergo apoptosis while integrin mediated matrix contacts are lost. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant animals may show enhanced cytokine response and increased IL-6 production following TNF challenge. Studies on two different alleles of this gene are not in agreement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Bag4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Bag4 APN 8 25771225 missense probably benign
IGL02074:Bag4 APN 8 25769355 missense possibly damaging 0.87
IGL02129:Bag4 APN 8 25768085 missense probably damaging 1.00
IGL02183:Bag4 APN 8 25768030 missense probably damaging 1.00
IGL02441:Bag4 APN 8 25768108 missense probably damaging 1.00
R0414:Bag4 UTSW 8 25767997 missense possibly damaging 0.91
R1103:Bag4 UTSW 8 25767863 utr 3 prime probably benign
R1423:Bag4 UTSW 8 25768274 missense probably damaging 0.99
R1650:Bag4 UTSW 8 25777424 missense probably damaging 0.99
R2045:Bag4 UTSW 8 25769488 missense probably benign
R2333:Bag4 UTSW 8 25769488 missense probably benign
R2945:Bag4 UTSW 8 25771252 missense probably benign 0.08
R3124:Bag4 UTSW 8 25769488 missense probably benign
R3125:Bag4 UTSW 8 25769488 missense probably benign
R4428:Bag4 UTSW 8 25769488 missense probably benign
R4429:Bag4 UTSW 8 25769488 missense probably benign
R4431:Bag4 UTSW 8 25769488 missense probably benign
R4482:Bag4 UTSW 8 25785044 unclassified probably benign
R4538:Bag4 UTSW 8 25769488 missense probably benign
R4539:Bag4 UTSW 8 25769488 missense probably benign
R4541:Bag4 UTSW 8 25769488 missense probably benign
R4542:Bag4 UTSW 8 25769488 missense probably benign
R4663:Bag4 UTSW 8 25769488 missense probably benign
R4708:Bag4 UTSW 8 25769488 missense probably benign
R4710:Bag4 UTSW 8 25769488 missense probably benign
R4732:Bag4 UTSW 8 25769488 missense probably benign
R4733:Bag4 UTSW 8 25769488 missense probably benign
R4970:Bag4 UTSW 8 25771244 nonsense probably null
R5175:Bag4 UTSW 8 25768351 missense probably damaging 0.99
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6084:Bag4 UTSW 8 25771231 missense probably benign 0.00
R6595:Bag4 UTSW 8 25769500 missense probably damaging 1.00
R6596:Bag4 UTSW 8 25769500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACCTTAGGCTGCTGAG -3'
(R):5'- AGCCAGGTTTTCTCAGGTG -3'

Sequencing Primer
(F):5'- CCTTAGGCTGCTGAGGTGGG -3'
(R):5'- CTCAGGTGTGGAGAACTTTTGGTAAC -3'
Posted On2015-07-21