Incidental Mutation 'R4467:Olfr786'
ID329249
Institutional Source Beutler Lab
Gene Symbol Olfr786
Ensembl Gene ENSMUSG00000095696
Gene Nameolfactory receptor 786
SynonymsGA_x6K02T2PULF-11116958-11117896, MOR111-5
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129427306-129439080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129437064 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 84 (I84T)
Ref Sequence ENSEMBL: ENSMUSP00000145099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076508] [ENSMUST00000204529]
Predicted Effect probably benign
Transcript: ENSMUST00000076508
AA Change: I84T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000075827
Gene: ENSMUSG00000095696
AA Change: I84T

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 7.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204529
AA Change: I84T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145099
Gene: ENSMUSG00000095696
AA Change: I84T

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 7.3e-20 PFAM
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Olfr786
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Olfr786 APN 10 129437034 missense possibly damaging 0.95
IGL03027:Olfr786 APN 10 129436911 missense probably damaging 1.00
IGL03177:Olfr786 APN 10 129436815 start codon destroyed probably null 0.82
IGL03216:Olfr786 APN 10 129436937 missense probably damaging 0.98
IGL03265:Olfr786 APN 10 129436925 missense possibly damaging 0.83
R0080:Olfr786 UTSW 10 129437271 missense possibly damaging 0.85
R0082:Olfr786 UTSW 10 129437271 missense possibly damaging 0.85
R0242:Olfr786 UTSW 10 129437348 missense probably damaging 1.00
R0242:Olfr786 UTSW 10 129437348 missense probably damaging 1.00
R0507:Olfr786 UTSW 10 129437288 missense probably benign 0.00
R1432:Olfr786 UTSW 10 129436938 missense probably damaging 1.00
R1563:Olfr786 UTSW 10 129437711 missense probably benign
R2023:Olfr786 UTSW 10 129437582 missense probably damaging 0.99
R2142:Olfr786 UTSW 10 129437747 missense probably benign 0.14
R2279:Olfr786 UTSW 10 129437657 missense probably benign 0.07
R3412:Olfr786 UTSW 10 129437307 missense probably damaging 0.99
R4529:Olfr786 UTSW 10 129437418 missense probably benign 0.03
R4843:Olfr786 UTSW 10 129437447 missense probably benign 0.01
R4888:Olfr786 UTSW 10 129437379 missense possibly damaging 0.95
R4890:Olfr786 UTSW 10 129437079 missense probably benign 0.08
R6255:Olfr786 UTSW 10 129437688 missense possibly damaging 0.95
R6362:Olfr786 UTSW 10 129436943 missense probably damaging 1.00
R6705:Olfr786 UTSW 10 129437072 missense probably benign 0.00
X0052:Olfr786 UTSW 10 129437499 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGGATTGTCAGATGACCC -3'
(R):5'- AGGCAAAGACCAACATTTTGCAG -3'

Sequencing Primer
(F):5'- CCAAAGCTCCAGGTTGTGATC -3'
(R):5'- AGACCTTCTGACTCATGATGGTCAG -3'
Posted On2015-07-21