Incidental Mutation 'R4467:Slc22a7'
ID329256
Institutional Source Beutler Lab
Gene Symbol Slc22a7
Ensembl Gene ENSMUSG00000067144
Gene Namesolute carrier family 22 (organic anion transporter), member 7
SynonymsNLT, OAT2
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46432185-46438477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46432510 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 532 (I532V)
Ref Sequence ENSEMBL: ENSMUSP00000084234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024764] [ENSMUST00000087012] [ENSMUST00000113465] [ENSMUST00000165993]
Predicted Effect probably benign
Transcript: ENSMUST00000024764
SMART Domains Protein: ENSMUSP00000024764
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087012
AA Change: I532V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084234
Gene: ENSMUSG00000067144
AA Change: I532V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 82 479 1.2e-32 PFAM
Pfam:Sugar_tr 86 524 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113465
SMART Domains Protein: ENSMUSP00000109092
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165811
Predicted Effect probably benign
Transcript: ENSMUST00000165993
SMART Domains Protein: ENSMUSP00000130072
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169441
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Slc22a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Slc22a7 APN 17 46437994 splice site probably null
R0755:Slc22a7 UTSW 17 46438187 missense possibly damaging 0.93
R0898:Slc22a7 UTSW 17 46433149 missense probably damaging 1.00
R1594:Slc22a7 UTSW 17 46438031 missense possibly damaging 0.94
R1794:Slc22a7 UTSW 17 46433153 missense probably damaging 1.00
R1900:Slc22a7 UTSW 17 46438231 missense probably benign 0.00
R1973:Slc22a7 UTSW 17 46437090 missense probably damaging 1.00
R2117:Slc22a7 UTSW 17 46433972 missense possibly damaging 0.55
R4739:Slc22a7 UTSW 17 46434997 missense probably damaging 1.00
R4921:Slc22a7 UTSW 17 46436933 missense probably benign 0.00
R6982:Slc22a7 UTSW 17 46434637 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCCCCAAATGCCACAGCTG -3'
(R):5'- TATGGCCATACCTTTATGTAGTCTC -3'

Sequencing Primer
(F):5'- TTATTTACAGAAGTCCCCCACC -3'
(R):5'- GCCATACCTTTATGTAGTCTCAAATG -3'
Posted On2015-07-21