Incidental Mutation 'R4469:Ubp1'
ID329327
Institutional Source Beutler Lab
Gene Symbol Ubp1
Ensembl Gene ENSMUSG00000009741
Gene Nameupstream binding protein 1
SynonymsNF2d9, LBP-1b, LBP-1a
MMRRC Submission 041726-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4469 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location113930934-113977202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113958707 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 222 (T222I)
Ref Sequence ENSEMBL: ENSMUSP00000150023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009885] [ENSMUST00000084885] [ENSMUST00000116492] [ENSMUST00000117537] [ENSMUST00000214095] [ENSMUST00000216558]
Predicted Effect probably benign
Transcript: ENSMUST00000009885
AA Change: T222I

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000009885
Gene: ENSMUSG00000009741
AA Change: T222I

DomainStartEndE-ValueType
Pfam:CP2 37 259 1.6e-76 PFAM
SCOP:d1kw4a_ 333 381 5e-3 SMART
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084885
AA Change: T222I

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081946
Gene: ENSMUSG00000009741
AA Change: T222I

DomainStartEndE-ValueType
Pfam:CP2 42 257 3e-62 PFAM
SCOP:d1kw4a_ 369 417 6e-3 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116492
AA Change: T222I

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112192
Gene: ENSMUSG00000009741
AA Change: T222I

DomainStartEndE-ValueType
Pfam:CP2 37 259 1.6e-76 PFAM
SCOP:d1kw4a_ 333 381 5e-3 SMART
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117537
SMART Domains Protein: ENSMUSP00000114075
Gene: ENSMUSG00000032507

DomainStartEndE-ValueType
FBOX 15 55 1.18e-6 SMART
LRR 77 102 1.16e-1 SMART
LRR 103 128 5.21e-4 SMART
LRR 129 154 2.24e-3 SMART
LRR_CC 155 180 5.46e-7 SMART
LRR 181 206 7.05e-1 SMART
LRR 207 232 4.87e-4 SMART
LRR 233 258 1.5e-4 SMART
LRR 259 284 8.81e-2 SMART
LRR 285 310 2.05e-2 SMART
LRR_CC 311 336 6.37e-8 SMART
LRR 365 391 2.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214095
AA Change: T222I

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216558
AA Change: T222I

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216891
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,382,425 L257P probably damaging Het
4833420G17Rik A G 13: 119,469,809 K196E probably damaging Het
Ackr1 T C 1: 173,332,545 probably null Het
Adgra1 C T 7: 139,876,061 T535I probably damaging Het
Ankrd11 A G 8: 122,896,587 Y310H probably damaging Het
Arhgef5 T C 6: 43,275,099 I928T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asb4 C A 6: 5,423,409 F185L probably benign Het
Ces2g A T 8: 104,965,970 I301F probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Cntnap4 A T 8: 112,665,266 N121I probably damaging Het
Csf1 C T 3: 107,750,681 probably null Het
Dnah7a T A 1: 53,444,526 H3364L probably benign Het
Dnmt3c A G 2: 153,720,360 T555A possibly damaging Het
Dst A G 1: 34,191,842 T3017A probably benign Het
Efcab7 A G 4: 99,909,704 D482G possibly damaging Het
Fbxl5 A G 5: 43,768,186 V154A probably damaging Het
Flt3 T C 5: 147,375,644 silent Het
G6pd2 A T 5: 61,808,945 Y21F probably benign Het
Gm9376 C T 14: 118,267,599 P148S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
Hcrtr2 T A 9: 76,230,556 T426S probably benign Het
Herc3 T A 6: 58,876,809 Y613* probably null Het
Hsd17b1 A T 11: 101,080,012 M265L probably benign Het
Ier3ip1 A G 18: 76,940,598 probably benign Het
Kif11 A G 19: 37,416,492 M924V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mfsd4b1 T C 10: 40,012,095 probably benign Het
Nlrc5 A T 8: 94,520,839 I1588F probably damaging Het
Nostrin C G 2: 69,175,717 I248M probably damaging Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr125 T C 17: 37,835,716 L239P probably benign Het
Rabggta A G 14: 55,716,487 V266A probably benign Het
Ror2 G A 13: 53,131,980 T66M possibly damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Smad9 T C 3: 54,782,761 V134A probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Ssbp2 G A 13: 91,694,056 G302D probably damaging Het
Stom T C 2: 35,321,533 N159D possibly damaging Het
Trav16d-dv11 A G 14: 53,047,578 K37R probably benign Het
Trim75 A G 8: 64,983,717 V27A probably damaging Het
Ttn T C 2: 76,717,761 T32066A probably damaging Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Unc5cl C G 17: 48,459,805 P69R possibly damaging Het
Zfp616 T A 11: 74,071,124 C24S probably damaging Het
Other mutations in Ubp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Ubp1 APN 9 113956758 missense probably damaging 1.00
IGL01951:Ubp1 APN 9 113951618 nonsense probably null
R0097:Ubp1 UTSW 9 113973507 splice site probably benign
R0097:Ubp1 UTSW 9 113973507 splice site probably benign
R0241:Ubp1 UTSW 9 113966587 critical splice donor site probably null
R0669:Ubp1 UTSW 9 113964668 splice site probably benign
R0709:Ubp1 UTSW 9 113944931 missense probably damaging 1.00
R1416:Ubp1 UTSW 9 113970171 missense probably benign 0.02
R1466:Ubp1 UTSW 9 113944835 splice site probably benign
R1753:Ubp1 UTSW 9 113955969 missense possibly damaging 0.74
R1780:Ubp1 UTSW 9 113964579 missense possibly damaging 0.84
R2235:Ubp1 UTSW 9 113964644 missense probably damaging 1.00
R3418:Ubp1 UTSW 9 113951686 critical splice donor site probably null
R3978:Ubp1 UTSW 9 113956705 critical splice acceptor site probably null
R4024:Ubp1 UTSW 9 113944883 missense probably benign 0.03
R4797:Ubp1 UTSW 9 113956002 missense probably damaging 1.00
R4984:Ubp1 UTSW 9 113959392 missense probably damaging 0.97
R5914:Ubp1 UTSW 9 113956739 missense probably benign 0.00
R6971:Ubp1 UTSW 9 113972763 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGGGTCTTCATTGTACATCC -3'
(R):5'- AGGCTGCTCTGCATTACCTC -3'

Sequencing Primer
(F):5'- TCTTCATTGTACATCCATGAGGG -3'
(R):5'- CTCTGCATTACCTCTGTGAGAATGG -3'
Posted On2015-07-21