Incidental Mutation 'R4471:Zfp777'
ID329426
Institutional Source Beutler Lab
Gene Symbol Zfp777
Ensembl Gene ENSMUSG00000071477
Gene Namezinc finger protein 777
Synonyms
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R4471 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48024188-48048911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48042107 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 342 (W342R)
Ref Sequence ENSEMBL: ENSMUSP00000110230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095944] [ENSMUST00000114583] [ENSMUST00000125385] [ENSMUST00000147281]
Predicted Effect probably damaging
Transcript: ENSMUST00000095944
AA Change: W298R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093637
Gene: ENSMUSG00000071477
AA Change: W298R

DomainStartEndE-ValueType
Pfam:DUF3669 177 256 4.3e-12 PFAM
KRAB 284 344 1.6e-29 SMART
low complexity region 422 433 N/A INTRINSIC
coiled coil region 454 477 N/A INTRINSIC
low complexity region 489 505 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 539 555 N/A INTRINSIC
ZnF_C2H2 557 579 1.2e-5 SMART
ZnF_C2H2 585 607 3.8e-5 SMART
ZnF_C2H2 646 668 1.1e-6 SMART
ZnF_C2H2 674 696 4.6e-6 SMART
ZnF_C2H2 704 726 3.2e-7 SMART
ZnF_C2H2 732 754 3.3e-6 SMART
ZnF_C2H2 760 782 8.4e-6 SMART
ZnF_C2H2 788 810 4.9e-5 SMART
ZnF_C2H2 816 838 1.1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114583
AA Change: W342R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110230
Gene: ENSMUSG00000071477
AA Change: W342R

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:DUF3669 231 298 4.7e-12 PFAM
KRAB 328 388 3.96e-27 SMART
low complexity region 466 477 N/A INTRINSIC
coiled coil region 498 521 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
low complexity region 583 599 N/A INTRINSIC
ZnF_C2H2 601 623 2.95e-3 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 690 712 2.43e-4 SMART
ZnF_C2H2 718 740 1.12e-3 SMART
ZnF_C2H2 748 770 7.49e-5 SMART
ZnF_C2H2 776 798 7.9e-4 SMART
ZnF_C2H2 804 826 1.95e-3 SMART
ZnF_C2H2 832 854 1.18e-2 SMART
ZnF_C2H2 860 882 2.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125385
Predicted Effect probably benign
Transcript: ENSMUST00000147281
Predicted Effect unknown
Transcript: ENSMUST00000148362
AA Change: W150R
SMART Domains Protein: ENSMUSP00000116303
Gene: ENSMUSG00000071477
AA Change: W150R

DomainStartEndE-ValueType
Pfam:DUF3669 40 107 6.1e-13 PFAM
KRAB 137 197 3.96e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203645
Meta Mutation Damage Score 0.546 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Zfp777
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Zfp777 APN 6 48043984 missense probably damaging 1.00
IGL01916:Zfp777 APN 6 48025342 missense probably damaging 1.00
IGL01959:Zfp777 APN 6 48044341 missense probably benign
IGL02167:Zfp777 APN 6 48044526 missense probably damaging 0.98
IGL03150:Zfp777 APN 6 48044125 missense probably damaging 1.00
R0238:Zfp777 UTSW 6 48024969 missense probably damaging 0.99
R0238:Zfp777 UTSW 6 48024969 missense probably damaging 0.99
R0372:Zfp777 UTSW 6 48044476 missense possibly damaging 0.62
R0762:Zfp777 UTSW 6 48029360 missense probably damaging 1.00
R1300:Zfp777 UTSW 6 48025770 missense probably benign 0.43
R1727:Zfp777 UTSW 6 48043890 missense probably damaging 0.99
R1906:Zfp777 UTSW 6 48042061 missense probably damaging 0.99
R2047:Zfp777 UTSW 6 48044346 missense probably benign
R2097:Zfp777 UTSW 6 48044242 missense probably benign 0.08
R2211:Zfp777 UTSW 6 48043885 missense possibly damaging 0.79
R2898:Zfp777 UTSW 6 48025660 missense probably damaging 0.97
R3123:Zfp777 UTSW 6 48029116 unclassified probably benign
R3832:Zfp777 UTSW 6 48044215 missense probably benign 0.00
R4019:Zfp777 UTSW 6 48042112 missense probably damaging 1.00
R4077:Zfp777 UTSW 6 48025522 missense probably benign
R5021:Zfp777 UTSW 6 48042127 missense probably damaging 0.99
R5030:Zfp777 UTSW 6 48037667 missense probably damaging 0.99
R5819:Zfp777 UTSW 6 48037588 missense probably damaging 0.99
R6544:Zfp777 UTSW 6 48044485 missense probably damaging 0.98
R6736:Zfp777 UTSW 6 48024856 missense probably damaging 0.99
R6971:Zfp777 UTSW 6 48024691 missense probably damaging 1.00
R7240:Zfp777 UTSW 6 48044449 missense probably benign 0.00
R7258:Zfp777 UTSW 6 48025797 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTTTGCCTTTTCCCAATACAGG -3'
(R):5'- AGGCAAGATGAGTCCTCCAC -3'

Sequencing Primer
(F):5'- ATACAGGAGCTGCTGTTCAC -3'
(R):5'- GCAGAATGTTGATAAGGCTCCCTAC -3'
Posted On2015-07-21