Incidental Mutation 'R4471:Olfr26'
ID329438
Institutional Source Beutler Lab
Gene Symbol Olfr26
Ensembl Gene ENSMUSG00000047667
Gene Nameolfactory receptor 26
SynonymsMTPCR09, MOR171-9, GA_x6K02T2PVTD-32550930-32551856
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4471 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38855060-38855990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38855631 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 190 (S190P)
Ref Sequence ENSEMBL: ENSMUSP00000100467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104874] [ENSMUST00000217350]
Predicted Effect probably damaging
Transcript: ENSMUST00000104874
AA Change: S190P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100467
Gene: ENSMUSG00000047667
AA Change: S190P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 2.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217350
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Olfr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Olfr26 APN 9 38855799 missense probably benign 0.00
IGL01909:Olfr26 APN 9 38855717 nonsense probably null
IGL02146:Olfr26 APN 9 38855358 missense probably benign 0.01
IGL02229:Olfr26 APN 9 38855416 missense possibly damaging 0.62
IGL02382:Olfr26 APN 9 38855068 missense probably benign
IGL03007:Olfr26 APN 9 38855296 missense probably damaging 1.00
IGL03118:Olfr26 APN 9 38855230 missense probably damaging 1.00
PIT4403001:Olfr26 UTSW 9 38855380 missense probably benign 0.39
R0590:Olfr26 UTSW 9 38855470 missense probably damaging 0.99
R0862:Olfr26 UTSW 9 38855182 missense possibly damaging 0.89
R1779:Olfr26 UTSW 9 38855550 missense possibly damaging 0.55
R1796:Olfr26 UTSW 9 38855524 missense probably benign 0.01
R2083:Olfr26 UTSW 9 38855341 missense probably benign 0.10
R3420:Olfr26 UTSW 9 38855325 missense possibly damaging 0.92
R3421:Olfr26 UTSW 9 38855325 missense possibly damaging 0.92
R4328:Olfr26 UTSW 9 38855836 missense possibly damaging 0.62
R4470:Olfr26 UTSW 9 38855631 missense probably damaging 1.00
R5047:Olfr26 UTSW 9 38855289 missense probably benign 0.36
R5267:Olfr26 UTSW 9 38855805 missense probably damaging 1.00
R5318:Olfr26 UTSW 9 38855448 missense probably damaging 1.00
R6502:Olfr26 UTSW 9 38855637 missense probably damaging 0.99
R7221:Olfr26 UTSW 9 38855242 missense probably damaging 1.00
R7297:Olfr26 UTSW 9 38855949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGCCATGGCGTATGATC -3'
(R):5'- CACAGCCATAAGATGAGAGCTG -3'

Sequencing Primer
(F):5'- ATCGCTATGTGGCCATCTGTAGAC -3'
(R):5'- AGCTGCAGGTTCCAAAGGATTTG -3'
Posted On2015-07-21