Incidental Mutation 'R4471:Slc16a3'
ID329451
Institutional Source Beutler Lab
Gene Symbol Slc16a3
Ensembl Gene ENSMUSG00000025161
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 3
SynonymsMCT4, monocarboxylate transporter 4, MCT3
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4471 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120948480-120960868 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 120955948 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070653] [ENSMUST00000100130] [ENSMUST00000129473] [ENSMUST00000133029] [ENSMUST00000154187] [ENSMUST00000168579]
Predicted Effect probably benign
Transcript: ENSMUST00000070653
SMART Domains Protein: ENSMUSP00000068854
Gene: ENSMUSG00000025161

DomainStartEndE-ValueType
Pfam:MFS_1 25 375 6.3e-32 PFAM
transmembrane domain 390 412 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100130
SMART Domains Protein: ENSMUSP00000097706
Gene: ENSMUSG00000025161

DomainStartEndE-ValueType
Pfam:MFS_1 25 375 6.3e-32 PFAM
transmembrane domain 390 412 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129473
SMART Domains Protein: ENSMUSP00000117275
Gene: ENSMUSG00000025161

DomainStartEndE-ValueType
Pfam:MFS_1 25 290 5.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140467
Predicted Effect probably benign
Transcript: ENSMUST00000154187
SMART Domains Protein: ENSMUSP00000122784
Gene: ENSMUSG00000025161

DomainStartEndE-ValueType
Pfam:MFS_1 25 253 3.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168579
SMART Domains Protein: ENSMUSP00000125846
Gene: ENSMUSG00000025161

DomainStartEndE-ValueType
Pfam:MFS_1 25 375 8.3e-32 PFAM
transmembrane domain 390 412 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lactic acid and pyruvate transport across plasma membranes is catalyzed by members of the proton-linked monocarboxylate transporter (MCT) family, which has been designated solute carrier family-16. Each MCT appears to have slightly different substrate and inhibitor specificities and transport kinetics, which are related to the metabolic requirements of the tissues in which it is found. The MCTs, which include MCT1 (SLC16A1; MIM 600682) and MCT2 (SLC16A7; MIM 603654), are characterized by 12 predicted transmembrane domains (Price et al., 1998 [PubMed 9425115]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Slc16a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Slc16a3 APN 11 120956706 nonsense probably null
IGL01943:Slc16a3 APN 11 120956883 unclassified probably null
IGL01967:Slc16a3 APN 11 120957038 missense probably damaging 0.99
IGL01970:Slc16a3 APN 11 120957038 missense probably damaging 0.99
IGL02189:Slc16a3 APN 11 120956771 missense probably benign 0.01
PIT4131001:Slc16a3 UTSW 11 120955346 missense probably damaging 1.00
R0010:Slc16a3 UTSW 11 120956705 missense probably benign 0.00
R0466:Slc16a3 UTSW 11 120958052 missense possibly damaging 0.77
R3967:Slc16a3 UTSW 11 120955425 missense possibly damaging 0.63
R4913:Slc16a3 UTSW 11 120957968 missense probably benign
R5826:Slc16a3 UTSW 11 120956930 missense probably benign
R5863:Slc16a3 UTSW 11 120957953 missense probably benign
R6019:Slc16a3 UTSW 11 120957105 unclassified probably null
X0022:Slc16a3 UTSW 11 120956702 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCACTAAGGACCTGACACC -3'
(R):5'- TAAATGGGTCTCGACGTCCAAG -3'

Sequencing Primer
(F):5'- AGCACCCCTGTTAGGCTGAG -3'
(R):5'- TCGACGTCCAAGCCCTCAG -3'
Posted On2015-07-21