Incidental Mutation 'R4471:Taf2'
ID329461
Institutional Source Beutler Lab
Gene Symbol Taf2
Ensembl Gene ENSMUSG00000037343
Gene NameTATA-box binding protein associated factor 2
SynonymsCIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R4471 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location55015131-55072152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55058880 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 337 (D337G)
Ref Sequence ENSEMBL: ENSMUSP00000043733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041733]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041733
AA Change: D337G

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: D337G

DomainStartEndE-ValueType
Pfam:Peptidase_M1 21 406 5.6e-17 PFAM
SCOP:d1gw5a_ 606 973 6e-7 SMART
low complexity region 987 998 N/A INTRINSIC
low complexity region 1142 1175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226864
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Taf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Taf2 APN 15 55071449 critical splice acceptor site probably null
IGL00475:Taf2 APN 15 55055850 nonsense probably null
IGL00549:Taf2 APN 15 55031115 missense probably benign 0.03
IGL00839:Taf2 APN 15 55045778 nonsense probably null
IGL01089:Taf2 APN 15 55016581 missense probably benign
IGL01305:Taf2 APN 15 55048274 missense probably damaging 0.99
IGL01532:Taf2 APN 15 55049486 missense possibly damaging 0.94
IGL01903:Taf2 APN 15 55060016 missense probably benign 0.03
IGL02324:Taf2 APN 15 55028376 missense probably benign
IGL02328:Taf2 APN 15 55028376 missense probably benign
IGL02405:Taf2 APN 15 55034155 splice site probably benign
IGL02671:Taf2 APN 15 55034176 missense probably benign 0.01
IGL02832:Taf2 APN 15 55016563 missense probably benign 0.01
IGL03105:Taf2 APN 15 55045799 missense probably benign 0.26
IGL03118:Taf2 APN 15 55052163 missense probably damaging 1.00
ANU22:Taf2 UTSW 15 55048274 missense probably damaging 0.99
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0183:Taf2 UTSW 15 55055790 missense possibly damaging 0.89
R0326:Taf2 UTSW 15 55047460 missense probably damaging 0.97
R0362:Taf2 UTSW 15 55045929 missense probably damaging 1.00
R0423:Taf2 UTSW 15 55064682 missense probably benign 0.02
R0562:Taf2 UTSW 15 55022188 splice site probably benign
R0609:Taf2 UTSW 15 55060050 missense probably damaging 1.00
R0655:Taf2 UTSW 15 55038294 missense probably damaging 1.00
R0689:Taf2 UTSW 15 55063065 missense possibly damaging 0.60
R0743:Taf2 UTSW 15 55016461 small deletion probably benign
R0898:Taf2 UTSW 15 55060084 missense probably damaging 0.97
R0969:Taf2 UTSW 15 55031157 critical splice acceptor site probably null
R0974:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1160:Taf2 UTSW 15 55071397 missense probably benign 0.01
R1376:Taf2 UTSW 15 55016461 small deletion probably benign
R1388:Taf2 UTSW 15 55036625 missense probably benign 0.00
R1416:Taf2 UTSW 15 55038410 missense possibly damaging 0.95
R1458:Taf2 UTSW 15 55059915 missense probably damaging 0.99
R1477:Taf2 UTSW 15 55062172 missense possibly damaging 0.87
R1755:Taf2 UTSW 15 55016454 missense probably damaging 1.00
R1766:Taf2 UTSW 15 55071397 missense probably benign 0.01
R2090:Taf2 UTSW 15 55016486 missense probably damaging 0.99
R2228:Taf2 UTSW 15 55064646 missense possibly damaging 0.94
R2519:Taf2 UTSW 15 55052247 missense probably benign 0.03
R4073:Taf2 UTSW 15 55052237 missense probably damaging 1.00
R4470:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4472:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4716:Taf2 UTSW 15 55065968 missense probably benign 0.02
R4937:Taf2 UTSW 15 55027223 nonsense probably null
R5082:Taf2 UTSW 15 55060045 missense probably benign 0.41
R5335:Taf2 UTSW 15 55045740 missense probably benign 0.14
R5383:Taf2 UTSW 15 55049419 missense possibly damaging 0.78
R5771:Taf2 UTSW 15 55059939 missense probably benign 0.01
R5862:Taf2 UTSW 15 55048323 missense possibly damaging 0.95
R5873:Taf2 UTSW 15 55038422 missense probably benign 0.00
R5908:Taf2 UTSW 15 55072006 unclassified probably benign
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6159:Taf2 UTSW 15 55063044 missense possibly damaging 0.48
R6568:Taf2 UTSW 15 55064630 missense probably damaging 1.00
R7094:Taf2 UTSW 15 55060086 missense probably benign 0.27
R7174:Taf2 UTSW 15 55048739 missense possibly damaging 0.51
R7241:Taf2 UTSW 15 55062141 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGCACGTCCAAATCTGCATTC -3'
(R):5'- AAGATTAGGAAACTTTTGGGGTGAC -3'

Sequencing Primer
(F):5'- TTGAAACAGGTGTCACCATGCTG -3'
(R):5'- AGGAAACTTTTGGGGTGACTATTC -3'
Posted On2015-07-21