Incidental Mutation 'R4435:Sos2'
ID329495
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission 041149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4435 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69614699 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 666 (E666G)
Ref Sequence ENSEMBL: ENSMUSP00000138793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
PDB Structure
ORIENTATION OF PEPTIDE FRAGMENTS FROM SOS PROTEINS BOUND TO THE N-TERMINAL SH3 DOMAIN OF GRB2 DETERMINED BY NMR SPECTROSCOPY [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000035773
AA Change: E665G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: E665G

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182396
AA Change: E633G

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: E633G

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183277
AA Change: E666G

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: E666G

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183306
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Arap1 C A 7: 101,390,254 R574S possibly damaging Het
Arhgap25 T C 6: 87,462,938 I576V possibly damaging Het
Ascc3 T A 10: 50,721,885 V1283D probably benign Het
Asnsd1 A T 1: 53,348,073 probably null Het
Asrgl1 C T 19: 9,119,199 V125I probably damaging Het
Bccip A G 7: 133,719,213 R239G probably benign Het
Cdyl T C 13: 35,858,250 probably null Het
Cyfip1 T C 7: 55,900,041 I650T probably damaging Het
Dennd4c C A 4: 86,798,075 Q506K probably benign Het
Fam135b T C 15: 71,448,739 D1313G probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Gm5134 T G 10: 75,995,824 S366A probably damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hk1 A G 10: 62,275,844 Y713H probably damaging Het
Ifih1 A G 2: 62,645,890 L14P probably damaging Het
Kmt2c A T 5: 25,314,877 N2078K possibly damaging Het
Maf T A 8: 115,706,853 E4V unknown Het
Mbtd1 T A 11: 93,932,222 D489E probably benign Het
Myrip C T 9: 120,335,614 probably benign Het
Nedd4l A G 18: 65,212,825 D816G possibly damaging Het
Nwd1 T C 8: 72,688,136 V934A possibly damaging Het
Olfr290 A G 7: 84,916,021 M81V probably benign Het
Olfr446 T A 6: 42,928,089 I286N probably damaging Het
Psd A T 19: 46,314,494 I158N probably damaging Het
Ptprq A G 10: 107,685,055 V752A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Senp2 T A 16: 22,014,241 V93E possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Slc38a4 T C 15: 97,009,018 S280G probably benign Het
Strip2 T C 6: 29,925,050 V129A probably benign Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Ttn T C 2: 76,916,875 E4610G probably benign Het
Uimc1 T C 13: 55,075,823 E212G probably damaging Het
Zc3h18 T C 8: 122,413,952 probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 unclassified probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
R7562:Sos2 UTSW 12 69635638 missense probably benign 0.12
R7570:Sos2 UTSW 12 69590880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGATAATCTACCATGTGACACAC -3'
(R):5'- AGTCAAAGGCTGTTTGCTTCTG -3'

Sequencing Primer
(F):5'- ACACAGATGATACAAATAACACGG -3'
(R):5'- GGATAAACAGTACTTGTGTTTTCTGC -3'
Posted On2015-07-21