Incidental Mutation 'R4436:Clec4a2'
ID329524
Institutional Source Beutler Lab
Gene Symbol Clec4a2
Ensembl Gene ENSMUSG00000030148
Gene NameC-type lectin domain family 4, member a2
SynonymsDcir1, dendritic cell immunoreceptor, DCIR, Clecsf6
MMRRC Submission 041702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4436 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123106428-123143999 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 123128054 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032248] [ENSMUST00000041779] [ENSMUST00000159891] [ENSMUST00000161365] [ENSMUST00000161636]
Predicted Effect probably null
Transcript: ENSMUST00000032248
SMART Domains Protein: ENSMUSP00000032248
Gene: ENSMUSG00000030148

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 131 256 1.18e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000041779
SMART Domains Protein: ENSMUSP00000045781
Gene: ENSMUSG00000030148

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
CLECT 107 232 1.18e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159891
Predicted Effect probably null
Transcript: ENSMUST00000161365
SMART Domains Protein: ENSMUSP00000124615
Gene: ENSMUSG00000030148

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
CLECT 107 232 1.18e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161636
SMART Domains Protein: ENSMUSP00000123973
Gene: ENSMUSG00000030148

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Meta Mutation Damage Score 0.524 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in inflammatory and immune response. Multiple transcript variants encoding distinct isoforms have been identified for this gene. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased IgG2a, IgG2b and IgG3 levels, increased B cell proliferation, enlarged lymph nodes and degeneration of seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Apopt1 T A 12: 111,751,208 D167E probably benign Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Ces2f G A 8: 104,953,156 R427H probably benign Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Mrvi1 T C 7: 110,876,917 E815G probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Pi4ka T C 16: 17,282,382 M1885V probably damaging Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r15a C T 7: 45,524,779 V202M probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Tubd1 C T 11: 86,548,919 S30F probably benign Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Xpo7 G A 14: 70,669,429 T945M probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Clec4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Clec4a2 APN 6 123139078 intron probably benign
IGL01384:Clec4a2 APN 6 123127988 missense probably damaging 1.00
IGL01481:Clec4a2 APN 6 123142500 missense probably benign 0.30
IGL02159:Clec4a2 APN 6 123139326 missense probably benign 0.04
IGL02436:Clec4a2 APN 6 123140678 missense possibly damaging 0.79
IGL03140:Clec4a2 APN 6 123140776 splice site probably benign
R0485:Clec4a2 UTSW 6 123123629 missense probably damaging 0.99
R1852:Clec4a2 UTSW 6 123139125 nonsense probably null
R3431:Clec4a2 UTSW 6 123139411 splice site probably null
R4524:Clec4a2 UTSW 6 123125084 missense probably damaging 1.00
R4736:Clec4a2 UTSW 6 123140663 missense probably damaging 1.00
R4740:Clec4a2 UTSW 6 123140663 missense probably damaging 1.00
R4908:Clec4a2 UTSW 6 123142503 missense probably damaging 1.00
R6516:Clec4a2 UTSW 6 123139406 missense probably damaging 1.00
R7394:Clec4a2 UTSW 6 123139120 missense unknown
X0024:Clec4a2 UTSW 6 123139081 intron probably benign
X0025:Clec4a2 UTSW 6 123139355 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GGAATTGTAGTCAGGCTCTGTTTAC -3'
(R):5'- GCAACCTGTTATGCCAAGTTCTATAG -3'

Sequencing Primer
(F):5'- CAGGCTCTGTTTACTTATGTAATGTG -3'
(R):5'- GCCAAGTTCTATAGATATCCCTGGG -3'
Posted On2015-07-21