Incidental Mutation 'R4436:Ppp1r15a'
ID329526
Institutional Source Beutler Lab
Gene Symbol Ppp1r15a
Ensembl Gene ENSMUSG00000040435
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 15A
SynonymsMyd116, Gadd34
MMRRC Submission 041702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R4436 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45522916-45526268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45524779 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 202 (V202M)
Ref Sequence ENSEMBL: ENSMUSP00000128497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000051810] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000167273] [ENSMUST00000210813] [ENSMUST00000210868] [ENSMUST00000211212] [ENSMUST00000211227]
Predicted Effect probably benign
Transcript: ENSMUST00000024233
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042105
AA Change: V202M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435
AA Change: V202M

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051810
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085331
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107758
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107762
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167273
AA Change: V202M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435
AA Change: V202M

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210813
Predicted Effect probably benign
Transcript: ENSMUST00000210868
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Predicted Effect probably benign
Transcript: ENSMUST00000211227
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The induction of this gene by ionizing radiation occurs in certain cell lines regardless of p53 status, and its protein response is correlated with apoptosis following ionizing radiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice show abnormal cellular responses to either ER- or oxidative- stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Apopt1 T A 12: 111,751,208 D167E probably benign Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Ces2f G A 8: 104,953,156 R427H probably benign Het
Clec4a2 G A 6: 123,128,054 probably null Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Mrvi1 T C 7: 110,876,917 E815G probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Pi4ka T C 16: 17,282,382 M1885V probably damaging Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Tubd1 C T 11: 86,548,919 S30F probably benign Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Xpo7 G A 14: 70,669,429 T945M probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Ppp1r15a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Ppp1r15a APN 7 45524379 unclassified probably benign
IGL02410:Ppp1r15a APN 7 45524055 missense probably damaging 1.00
IGL02658:Ppp1r15a APN 7 45524667 missense probably benign 0.02
IGL03156:Ppp1r15a APN 7 45525171 missense possibly damaging 0.82
R0179:Ppp1r15a UTSW 7 45525000 missense probably damaging 0.98
R0350:Ppp1r15a UTSW 7 45523018 missense probably damaging 0.99
R1220:Ppp1r15a UTSW 7 45523869 missense probably damaging 1.00
R4296:Ppp1r15a UTSW 7 45523749 nonsense probably null
R4854:Ppp1r15a UTSW 7 45525373 missense probably benign 0.01
R5822:Ppp1r15a UTSW 7 45523303 missense probably damaging 1.00
R6216:Ppp1r15a UTSW 7 45524022 missense probably damaging 1.00
R6574:Ppp1r15a UTSW 7 45524109 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCATTCCGACAAGGGTGAC -3'
(R):5'- GCCAGGACAAGATGACCTTAG -3'

Sequencing Primer
(F):5'- GACCCTGCCCTGCCCTG -3'
(R):5'- ATGGAACGCACAGCTGGC -3'
Posted On2015-07-21