Incidental Mutation 'R4436:Ces2f'
ID329529
Institutional Source Beutler Lab
Gene Symbol Ces2f
Ensembl Gene ENSMUSG00000062826
Gene Namecarboxylesterase 2F
Synonyms2310038E17Rik
MMRRC Submission 041702-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4436 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104947356-104960047 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104953156 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 427 (R427H)
Ref Sequence ENSEMBL: ENSMUSP00000148278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076384] [ENSMUST00000212820] [ENSMUST00000212926]
Predicted Effect probably benign
Transcript: ENSMUST00000076384
AA Change: R427H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075722
Gene: ENSMUSG00000062826
AA Change: R427H

DomainStartEndE-ValueType
Pfam:COesterase 12 540 2.7e-167 PFAM
Pfam:Abhydrolase_3 145 261 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212820
AA Change: R427H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect unknown
Transcript: ENSMUST00000212926
AA Change: R296H
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit epidermal and follicular hyperkeratosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Apopt1 T A 12: 111,751,208 D167E probably benign Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Clec4a2 G A 6: 123,128,054 probably null Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Mrvi1 T C 7: 110,876,917 E815G probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Pi4ka T C 16: 17,282,382 M1885V probably damaging Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r15a C T 7: 45,524,779 V202M probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Tubd1 C T 11: 86,548,919 S30F probably benign Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Xpo7 G A 14: 70,669,429 T945M probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Ces2f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Ces2f APN 8 104949973 missense probably damaging 1.00
IGL00160:Ces2f APN 8 104949972 missense probably damaging 1.00
IGL01680:Ces2f APN 8 104954073 missense probably benign 0.10
IGL01683:Ces2f APN 8 104953101 missense probably benign 0.39
IGL02685:Ces2f APN 8 104953098 nonsense probably null
R0545:Ces2f UTSW 8 104950036 missense possibly damaging 0.66
R0707:Ces2f UTSW 8 104950986 missense possibly damaging 0.88
R1170:Ces2f UTSW 8 104953546 missense probably damaging 0.99
R1476:Ces2f UTSW 8 104952502 missense possibly damaging 0.60
R4105:Ces2f UTSW 8 104951192 splice site probably null
R4394:Ces2f UTSW 8 104950954 missense probably damaging 1.00
R4601:Ces2f UTSW 8 104949964 missense probably damaging 1.00
R4986:Ces2f UTSW 8 104952025 missense probably benign 0.39
R5502:Ces2f UTSW 8 104952523 missense possibly damaging 0.60
R6610:Ces2f UTSW 8 104950106 critical splice donor site probably null
R7078:Ces2f UTSW 8 104954652 missense probably damaging 0.98
R7357:Ces2f UTSW 8 104949963 missense probably benign 0.03
R7480:Ces2f UTSW 8 104954706 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AATAGACCTCAATGGCATTCCC -3'
(R):5'- CAGATACCACTCAGCTGTTTCC -3'

Sequencing Primer
(F):5'- TAAGGATGTCGCCCACCC -3'
(R):5'- CCTCATCTGTACACAAATAAGATGTC -3'
Posted On2015-07-21