Incidental Mutation 'R0047:Hrc'
ID32953
Institutional Source Beutler Lab
Gene Symbol Hrc
Ensembl Gene ENSMUSG00000038239
Gene Namehistidine rich calcium binding protein
Synonyms
MMRRC Submission 038341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0047 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location45335290-45338974 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45336689 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 421 (S421R)
Ref Sequence ENSEMBL: ENSMUSP00000082459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000042194] [ENSMUST00000085351] [ENSMUST00000210248] [ENSMUST00000210541] [ENSMUST00000211067] [ENSMUST00000211327] [ENSMUST00000211431] [ENSMUST00000211743]
Predicted Effect probably benign
Transcript: ENSMUST00000003961
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085351
AA Change: S421R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000082459
Gene: ENSMUSG00000038239
AA Change: S421R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
internal_repeat_1 51 146 8.76e-11 PROSPERO
low complexity region 154 189 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 213 225 1e-4 PFAM
low complexity region 240 254 N/A INTRINSIC
low complexity region 260 274 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 308 324 2.2e-8 PFAM
low complexity region 340 353 N/A INTRINSIC
low complexity region 362 382 N/A INTRINSIC
internal_repeat_1 399 490 8.76e-11 PROSPERO
coiled coil region 536 565 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
coiled coil region 594 621 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210479
Predicted Effect probably benign
Transcript: ENSMUST00000210541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210844
Predicted Effect probably benign
Transcript: ENSMUST00000211067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211098
Predicted Effect probably benign
Transcript: ENSMUST00000211327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211411
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably benign
Transcript: ENSMUST00000211743
Meta Mutation Damage Score 0.0484 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (98/98)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired weight gain and weight loss around 1 year of age and increased susceptibility to induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,264 T405A probably damaging Het
4932438A13Rik T A 3: 36,908,192 L481M possibly damaging Het
Acer1 A T 17: 56,955,624 D175E possibly damaging Het
Acsf2 T C 11: 94,569,342 I395V probably benign Het
Adamts9 G A 6: 92,905,306 probably benign Het
Amigo3 T C 9: 108,054,658 S427P probably benign Het
Ankrd35 A G 3: 96,684,063 K555R probably benign Het
Arhgap35 A T 7: 16,561,992 H1049Q probably benign Het
Arhgef5 G A 6: 43,265,621 probably null Het
Arid4a T G 12: 71,075,419 L858W probably damaging Het
Bbox1 A G 2: 110,268,302 F310S probably damaging Het
Bhlhe22 T C 3: 18,055,569 L261P probably damaging Het
Bmper T A 9: 23,406,686 C534S probably damaging Het
Cacna1d T G 14: 30,346,790 probably benign Het
Camk2g G A 14: 20,771,068 probably benign Het
Capn12 G A 7: 28,890,387 probably null Het
Cdkl4 T G 17: 80,550,845 N115T probably benign Het
Chchd1 T C 14: 20,704,163 S48P possibly damaging Het
Chia1 G T 3: 106,115,257 C49F probably damaging Het
Cnot7 A G 8: 40,495,921 probably benign Het
Crh T C 3: 19,694,037 E147G probably damaging Het
Cux1 T C 5: 136,363,253 probably benign Het
Cyp2b19 T A 7: 26,766,826 D351E probably benign Het
Dctn1 G T 6: 83,182,632 G31* probably null Het
Duox1 T A 2: 122,346,641 probably benign Het
Egflam T G 15: 7,253,430 E382A possibly damaging Het
Ext1 T C 15: 53,345,146 N73S probably benign Het
Ffar4 A G 19: 38,114,004 probably benign Het
Glg1 A T 8: 111,165,582 M866K probably damaging Het
Golm1 T A 13: 59,645,100 H197L probably benign Het
Gtse1 A G 15: 85,862,378 K132E probably damaging Het
Gxylt2 A T 6: 100,733,378 probably benign Het
Ighg2c T A 12: 113,288,168 probably benign Het
Ihh A G 1: 74,946,591 I245T probably benign Het
Ilf3 T A 9: 21,388,714 M65K possibly damaging Het
Insr A G 8: 3,202,947 V404A probably damaging Het
Irak2 G T 6: 113,672,953 probably benign Het
Irak2 G A 6: 113,678,738 V367I probably benign Het
Kat7 A C 11: 95,300,208 N119K probably benign Het
Kif9 A G 9: 110,485,038 I33V probably benign Het
Klf17 A G 4: 117,761,032 Y43H probably benign Het
Kng2 T A 16: 22,987,563 T629S possibly damaging Het
Lama1 A T 17: 67,795,186 probably benign Het
Lamb1 T C 12: 31,278,601 I188T possibly damaging Het
Lpp T A 16: 24,661,800 probably benign Het
Lrp12 T C 15: 39,878,239 E360G probably damaging Het
Mark2 A C 19: 7,283,577 probably benign Het
Mmp3 T C 9: 7,451,910 probably benign Het
Mthfd1l T A 10: 3,978,727 probably benign Het
Mtr A T 13: 12,222,226 S569T probably damaging Het
Myh13 T A 11: 67,367,237 S1752T probably benign Het
Myo5a T A 9: 75,156,207 L565H probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nfkb1 A T 3: 135,595,053 L72* probably null Het
Numa1 A G 7: 102,009,453 K296E probably damaging Het
Olfr1477 A G 19: 13,502,589 E82G probably benign Het
Olfr186 T A 16: 59,027,224 M228L probably benign Het
Olfr201 C T 16: 59,269,211 G152D probably damaging Het
Olfr508 A G 7: 108,630,552 I187V probably benign Het
Olfr613 A T 7: 103,552,322 Y179F probably damaging Het
Pcdhb5 A T 18: 37,321,268 I234F possibly damaging Het
Pgm5 T A 19: 24,684,556 I545F probably damaging Het
Pla2g2c T C 4: 138,743,590 probably benign Het
Pnpla7 A T 2: 25,011,606 E548V probably damaging Het
Ppm1m C A 9: 106,196,696 E273* probably null Het
Ppp2r1b C T 9: 50,861,573 R117* probably null Het
Rabgap1l G A 1: 160,231,789 probably benign Het
Rapgef6 T A 11: 54,546,378 M49K possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rnf219 T A 14: 104,503,344 probably null Het
Rtel1 T G 2: 181,323,405 I146M probably damaging Het
Sdr9c7 A T 10: 127,903,672 M219L probably benign Het
Serpina3g T A 12: 104,240,284 S115T possibly damaging Het
Serpinb1a A T 13: 32,850,276 L44Q probably damaging Het
Slc13a4 A G 6: 35,287,362 I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 L177P probably damaging Het
Slc47a2 C T 11: 61,336,242 V167M possibly damaging Het
Snrnp200 C T 2: 127,234,954 probably benign Het
Snx13 C A 12: 35,101,124 probably benign Het
Snx25 C T 8: 46,041,365 A828T probably damaging Het
Spic A G 10: 88,675,941 L151P probably damaging Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Stk32a T C 18: 43,313,378 probably benign Het
Tbx3 A T 5: 119,680,446 E382V probably damaging Het
Tcaf2 A G 6: 42,629,613 I469T probably benign Het
Tln2 A G 9: 67,240,672 probably benign Het
Top2a T A 11: 98,997,856 I1260L probably benign Het
Treml1 C A 17: 48,364,980 S91* probably null Het
Trim26 T C 17: 36,857,864 probably benign Het
Trmt11 T C 10: 30,535,243 N418S probably benign Het
Ttf1 A G 2: 29,084,655 Y801C probably damaging Het
Usp34 C T 11: 23,464,403 A2782V probably benign Het
Vmn2r77 T C 7: 86,811,650 V728A probably benign Het
Vps4a T C 8: 107,036,701 L29P probably damaging Het
Wdfy3 A G 5: 101,944,033 I480T probably damaging Het
Wdr41 A G 13: 95,010,287 I197V probably damaging Het
Ywhag A T 5: 135,911,299 V147E probably damaging Het
Zan A G 5: 137,403,656 M4058T unknown Het
Zfp236 C T 18: 82,680,692 C88Y probably damaging Het
Other mutations in Hrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03379:Hrc APN 7 45337255 missense probably benign 0.27
R0017:Hrc UTSW 7 45336370 missense possibly damaging 0.71
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0310:Hrc UTSW 7 45336497 missense probably benign
R0436:Hrc UTSW 7 45336133 missense possibly damaging 0.53
R0534:Hrc UTSW 7 45337235 unclassified probably benign
R1230:Hrc UTSW 7 45336463 missense possibly damaging 0.85
R1808:Hrc UTSW 7 45336778 missense probably damaging 0.99
R1975:Hrc UTSW 7 45336214 missense probably damaging 0.98
R1977:Hrc UTSW 7 45336214 missense probably damaging 0.98
R2258:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R2260:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R3551:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R3552:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R4169:Hrc UTSW 7 45336757 missense probably benign 0.00
R5085:Hrc UTSW 7 45337021 missense probably damaging 0.99
R5204:Hrc UTSW 7 45335704 missense possibly damaging 0.96
R5215:Hrc UTSW 7 45336091 missense probably damaging 0.99
R5245:Hrc UTSW 7 45335431 missense probably damaging 1.00
R5390:Hrc UTSW 7 45335485 missense probably damaging 0.96
R5432:Hrc UTSW 7 45336861 missense possibly damaging 0.72
R5756:Hrc UTSW 7 45336706 missense possibly damaging 0.85
R5761:Hrc UTSW 7 45336601 unclassified probably null
R5905:Hrc UTSW 7 45336234 missense probably damaging 0.99
R6144:Hrc UTSW 7 45336733 missense possibly damaging 0.86
R6684:Hrc UTSW 7 45336532 missense possibly damaging 0.53
R6699:Hrc UTSW 7 45335695 missense possibly damaging 0.85
R6809:Hrc UTSW 7 45336379 missense probably benign
R6887:Hrc UTSW 7 45335664 missense probably benign 0.18
R7178:Hrc UTSW 7 45336261 missense possibly damaging 0.53
R7208:Hrc UTSW 7 45336565 missense possibly damaging 0.53
R7258:Hrc UTSW 7 45336296 missense possibly damaging 0.70
R7310:Hrc UTSW 7 45335803 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGATGAAGACGGTGACTCTGGTG -3'
(R):5'- AGCAATCTCTCCCTGAACAGGCTC -3'

Sequencing Primer
(F):5'- tgatgatgatgatgatgatgatgaag -3'
(R):5'- CTGAACAGGCTCTCTGTGAC -3'
Posted On2013-05-09