Incidental Mutation 'R4436:Bcl2a1d'
ID329530
Institutional Source Beutler Lab
Gene Symbol Bcl2a1d
Ensembl Gene ENSMUSG00000099974
Gene NameB cell leukemia/lymphoma 2 related protein A1d
SynonymsA1-d
MMRRC Submission 041702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4436 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location88723285-88731914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88731700 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 7 (M7K)
Ref Sequence ENSEMBL: ENSMUSP00000096087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098486]
Predicted Effect probably benign
Transcript: ENSMUST00000098486
AA Change: M7K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000096087
Gene: ENSMUSG00000099974
AA Change: M7K

DomainStartEndE-ValueType
BCL 37 140 3.98e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194289
Meta Mutation Damage Score 0.1344 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Apopt1 T A 12: 111,751,208 D167E probably benign Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Ces2f G A 8: 104,953,156 R427H probably benign Het
Clec4a2 G A 6: 123,128,054 probably null Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Mrvi1 T C 7: 110,876,917 E815G probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Pi4ka T C 16: 17,282,382 M1885V probably damaging Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r15a C T 7: 45,524,779 V202M probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Tubd1 C T 11: 86,548,919 S30F probably benign Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Xpo7 G A 14: 70,669,429 T945M probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Bcl2a1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2027:Bcl2a1d UTSW 9 88731385 missense possibly damaging 0.60
R2402:Bcl2a1d UTSW 9 88731496 missense probably damaging 1.00
R4250:Bcl2a1d UTSW 9 88731653 missense probably benign
R4352:Bcl2a1d UTSW 9 88731499 missense probably damaging 1.00
R4437:Bcl2a1d UTSW 9 88731700 missense probably benign 0.00
R4438:Bcl2a1d UTSW 9 88731700 missense probably benign 0.00
R4871:Bcl2a1d UTSW 9 88731695 missense probably damaging 1.00
R7137:Bcl2a1d UTSW 9 88731478 missense probably damaging 1.00
R7201:Bcl2a1d UTSW 9 88731586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGGTATCTATGGATTCCAC -3'
(R):5'- TTCAGAGTCTGAACTTTGGCTTTC -3'

Sequencing Primer
(F):5'- TGGATTCCACGTGAAAGTCATCC -3'
(R):5'- GAGTCTGAACTTTGGCTTTCACAGAC -3'
Posted On2015-07-21