Incidental Mutation 'R4436:Apopt1'
ID329544
Institutional Source Beutler Lab
Gene Symbol Apopt1
Ensembl Gene ENSMUSG00000037787
Gene Nameapoptogenic, mitochondrial 1
Synonyms1700081D05Rik, 2810002N01Rik, Apop-1
MMRRC Submission 041702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R4436 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111713261-111755053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111751208 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 167 (D167E)
Ref Sequence ENSEMBL: ENSMUSP00000131169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163220]
Predicted Effect probably benign
Transcript: ENSMUST00000160366
AA Change: D167E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123929
Gene: ENSMUSG00000037787
AA Change: D167E

DomainStartEndE-ValueType
Pfam:DUF2315 53 162 3.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163220
AA Change: D167E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131169
Gene: ENSMUSG00000037787
AA Change: D167E

DomainStartEndE-ValueType
Pfam:DUF2315 54 162 3.7e-46 PFAM
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the mitochondria, where it stimulates the release of cytochrome c, thereby promoting programmed cell death. Mutations in this gene have been found in individuals with mitochondrial complex IV deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Ces2f G A 8: 104,953,156 R427H probably benign Het
Clec4a2 G A 6: 123,128,054 probably null Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Mrvi1 T C 7: 110,876,917 E815G probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Pi4ka T C 16: 17,282,382 M1885V probably damaging Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r15a C T 7: 45,524,779 V202M probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Tubd1 C T 11: 86,548,919 S30F probably benign Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Xpo7 G A 14: 70,669,429 T945M probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Apopt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Apopt1 APN 12 111724413 splice site probably benign
R0336:Apopt1 UTSW 12 111733658 intron probably benign
R2324:Apopt1 UTSW 12 111724350 missense possibly damaging 0.87
R4774:Apopt1 UTSW 12 111713389 missense possibly damaging 0.66
R5161:Apopt1 UTSW 12 111722774 missense possibly damaging 0.55
R5376:Apopt1 UTSW 12 111730058 missense probably damaging 0.96
R5864:Apopt1 UTSW 12 111751218 missense probably benign 0.03
R6802:Apopt1 UTSW 12 111751191 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGTGTTGTGAAAACTCC -3'
(R):5'- GAGCATCCGACCTTAGTCAG -3'

Sequencing Primer
(F):5'- GTTGTGAAAACTCCATCATCCTCAG -3'
(R):5'- TTATGGCAGTAAAGTGCACCC -3'
Posted On2015-07-21