Incidental Mutation 'R4436:Olfr725'
ID329545
Institutional Source Beutler Lab
Gene Symbol Olfr725
Ensembl Gene ENSMUSG00000068437
Gene Nameolfactory receptor 725
SynonymsMOR246-3, GA_x6K02T2PMLR-5725741-5724776, MOR246-7_p
MMRRC Submission 041702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4436 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50034314-50040375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50034830 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 191 (D191G)
Ref Sequence ENSEMBL: ENSMUSP00000145828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089844] [ENSMUST00000206920]
Predicted Effect probably damaging
Transcript: ENSMUST00000089844
AA Change: D191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087282
Gene: ENSMUSG00000068437
AA Change: D191G

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 36 282 1.8e-7 PFAM
Pfam:7tm_1 41 287 5.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206920
AA Change: D191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Apopt1 T A 12: 111,751,208 D167E probably benign Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Ces2f G A 8: 104,953,156 R427H probably benign Het
Clec4a2 G A 6: 123,128,054 probably null Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Mrvi1 T C 7: 110,876,917 E815G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Pi4ka T C 16: 17,282,382 M1885V probably damaging Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r15a C T 7: 45,524,779 V202M probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Tubd1 C T 11: 86,548,919 S30F probably benign Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Xpo7 G A 14: 70,669,429 T945M probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Olfr725
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Olfr725 APN 14 50035050 missense probably benign 0.29
IGL01412:Olfr725 APN 14 50035313 missense probably benign
IGL03241:Olfr725 APN 14 50035068 missense possibly damaging 0.70
IGL03268:Olfr725 APN 14 50034567 missense probably damaging 0.98
IGL03348:Olfr725 APN 14 50034755 missense probably benign 0.00
R0358:Olfr725 UTSW 14 50035286 missense probably damaging 0.97
R0577:Olfr725 UTSW 14 50034792 missense probably damaging 1.00
R2094:Olfr725 UTSW 14 50034714 missense probably damaging 1.00
R2424:Olfr725 UTSW 14 50034824 missense probably damaging 1.00
R3421:Olfr725 UTSW 14 50034540 missense possibly damaging 0.66
R3422:Olfr725 UTSW 14 50034540 missense possibly damaging 0.66
R4437:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4438:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4684:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4717:Olfr725 UTSW 14 50035364 missense probably damaging 0.98
R5253:Olfr725 UTSW 14 50035288 missense possibly damaging 0.91
R5254:Olfr725 UTSW 14 50034678 missense possibly damaging 0.60
R5641:Olfr725 UTSW 14 50035289 missense probably benign 0.04
R5881:Olfr725 UTSW 14 50034987 missense probably benign 0.00
R5906:Olfr725 UTSW 14 50034849 missense probably benign 0.05
R6511:Olfr725 UTSW 14 50034809 missense probably damaging 1.00
X0062:Olfr725 UTSW 14 50034860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAACTGAATAGCCATTAAAGGG -3'
(R):5'- GACAATCATGAGTCGCCGTG -3'

Sequencing Primer
(F):5'- CCATTAAAGGGCCATGCATAG -3'
(R):5'- AGTCGCCGTGTGTGTATCACTC -3'
Posted On2015-07-21