Incidental Mutation 'R4437:Arhgef16'
ID329569
Institutional Source Beutler Lab
Gene Symbol Arhgef16
Ensembl Gene ENSMUSG00000029032
Gene NameRho guanine nucleotide exchange factor (GEF) 16
SynonymsNeuroblastoma
MMRRC Submission 041150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R4437 (G1)
Quality Score148
Status Not validated
Chromosome4
Chromosomal Location154278486-154301676 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 154279696 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000030898] [ENSMUST00000169623]
Predicted Effect probably benign
Transcript: ENSMUST00000030897
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000030898
SMART Domains Protein: ENSMUSP00000030898
Gene: ENSMUSG00000029032

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
RhoGEF 292 471 5.9e-52 SMART
PH 506 626 6.46e-8 SMART
SH3 636 692 2.31e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144145
Predicted Effect probably null
Transcript: ENSMUST00000169623
SMART Domains Protein: ENSMUSP00000126296
Gene: ENSMUSG00000029032

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
RhoGEF 292 471 5.9e-52 SMART
PH 506 626 6.46e-8 SMART
SH3 636 692 2.31e-12 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Although the specific function of this protein is not known yet, it is thought to be involved in protein-protein and protein-lipid interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
AW549877 T C 15: 3,991,836 E79G probably damaging Het
Bcar1 G A 8: 111,715,389 T273M probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Bptf A G 11: 107,074,474 V1235A possibly damaging Het
Camsap1 G A 2: 25,938,646 T1022I possibly damaging Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Col4a1 G T 8: 11,206,387 C1493* probably null Het
Cul9 A G 17: 46,502,159 L2378P probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Fam71d T A 12: 78,715,050 F163I probably damaging Het
Frem3 A G 8: 80,612,607 I510V probably benign Het
Gm2381 A T 7: 42,819,844 H285Q probably damaging Het
Gm4884 A G 7: 41,043,090 Q161R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv1-99 T G 6: 68,542,334 S91A probably benign Het
Itga6 T C 2: 71,825,638 L302P probably benign Het
Mdga2 T C 12: 66,473,198 probably null Het
Myoc A G 1: 162,649,112 M462V possibly damaging Het
Nkx2-4 T C 2: 147,084,259 T228A possibly damaging Het
Npr1 T G 3: 90,456,286 D810A probably damaging Het
Olfr1240 T G 2: 89,439,354 R308S possibly damaging Het
Olfr645 T C 7: 104,084,921 E53G possibly damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Pde4dip G A 3: 97,766,569 L344F possibly damaging Het
Pfas A G 11: 68,988,417 L1218P probably damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Robo2 T C 16: 73,973,244 T531A possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Vps33a A T 5: 123,531,884 I519N probably benign Het
Other mutations in Arhgef16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Arhgef16 APN 4 154280244 missense probably benign 0.01
IGL02422:Arhgef16 APN 4 154287065 nonsense probably null
IGL02801:Arhgef16 APN 4 154291507 missense probably damaging 0.99
IGL02928:Arhgef16 APN 4 154282893 missense probably benign 0.00
R0518:Arhgef16 UTSW 4 154291034 missense probably damaging 0.99
R1148:Arhgef16 UTSW 4 154280889 missense probably benign 0.05
R1148:Arhgef16 UTSW 4 154280889 missense probably benign 0.05
R1576:Arhgef16 UTSW 4 154291312 missense probably damaging 1.00
R1778:Arhgef16 UTSW 4 154287986 missense probably benign 0.17
R1853:Arhgef16 UTSW 4 154291106 missense probably benign 0.14
R1912:Arhgef16 UTSW 4 154280323 splice site probably null
R2269:Arhgef16 UTSW 4 154285033 missense probably damaging 0.98
R4690:Arhgef16 UTSW 4 154287963 splice site probably null
R5174:Arhgef16 UTSW 4 154282047 missense probably damaging 1.00
R5566:Arhgef16 UTSW 4 154285648 missense probably benign 0.01
R6348:Arhgef16 UTSW 4 154287083 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CCCTTTGGAGGTACTGAGTG -3'
(R):5'- AGCTGTCTATCTTGTGCTGAGAC -3'

Sequencing Primer
(F):5'- CACCTTGGAGCTTGCTAATGAAG -3'
(R):5'- AGACAGCTGGTGCCATGTGTC -3'
Posted On2015-07-21