Incidental Mutation 'R4438:Fgfr2'
ID329628
Institutional Source Beutler Lab
Gene Symbol Fgfr2
Ensembl Gene ENSMUSG00000030849
Gene Namefibroblast growth factor receptor 2
SynonymsFgfr-2, KGFRTr, Bek, Fgfr7, Fgfr-7, svs
MMRRC Submission 041703-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4438 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130162451-133123350 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 130172930 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 509 (R509*)
Ref Sequence ENSEMBL: ENSMUSP00000113993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117073] [ENSMUST00000117089] [ENSMUST00000117357] [ENSMUST00000117691] [ENSMUST00000117754] [ENSMUST00000117858] [ENSMUST00000117872] [ENSMUST00000118296] [ENSMUST00000119260] [ENSMUST00000120141] [ENSMUST00000120187] [ENSMUST00000120715] [ENSMUST00000121064] [ENSMUST00000121080] [ENSMUST00000122054] [ENSMUST00000122448] [ENSMUST00000124096] [ENSMUST00000153166]
Predicted Effect probably null
Transcript: ENSMUST00000117073
AA Change: R508*
SMART Domains Protein: ENSMUSP00000112672
Gene: ENSMUSG00000030849
AA Change: R508*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 234 7.41e-7 SMART
transmembrane domain 260 282 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
TyrKc 364 640 4.38e-152 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117089
AA Change: R624*
SMART Domains Protein: ENSMUSP00000112992
Gene: ENSMUSG00000030849
AA Change: R624*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 430 439 N/A INTRINSIC
TyrKc 480 756 4.38e-152 SMART
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117357
AA Change: R509*
SMART Domains Protein: ENSMUSP00000112580
Gene: ENSMUSG00000030849
AA Change: R509*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
low complexity region 669 683 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117691
AA Change: R626*
SMART Domains Protein: ENSMUSP00000113180
Gene: ENSMUSG00000030849
AA Change: R626*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
low complexity region 786 800 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117754
AA Change: R412*
SMART Domains Protein: ENSMUSP00000113187
Gene: ENSMUSG00000030849
AA Change: R412*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 136 7.41e-7 SMART
transmembrane domain 162 184 N/A INTRINSIC
low complexity region 218 227 N/A INTRINSIC
TyrKc 268 544 4.38e-152 SMART
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117858
AA Change: R626*
SMART Domains Protein: ENSMUSP00000112623
Gene: ENSMUSG00000030849
AA Change: R626*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117872
AA Change: R527*
SMART Domains Protein: ENSMUSP00000113994
Gene: ENSMUSG00000030849
AA Change: R527*

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 253 7.41e-7 SMART
transmembrane domain 279 301 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
TyrKc 383 659 4.38e-152 SMART
low complexity region 687 701 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118296
AA Change: R537*
SMART Domains Protein: ENSMUSP00000112471
Gene: ENSMUSG00000030849
AA Change: R537*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 343 352 N/A INTRINSIC
TyrKc 393 669 4.38e-152 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119260
AA Change: R623*
SMART Domains Protein: ENSMUSP00000113010
Gene: ENSMUSG00000030849
AA Change: R623*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 349 7.41e-7 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
TyrKc 479 755 4.38e-152 SMART
low complexity region 783 797 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120141
AA Change: R535*
SMART Domains Protein: ENSMUSP00000113415
Gene: ENSMUSG00000030849
AA Change: R535*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
TyrKc 391 667 4.38e-152 SMART
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120187
AA Change: R530*
SMART Domains Protein: ENSMUSP00000113248
Gene: ENSMUSG00000030849
AA Change: R530*

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 251 1.9e-4 SMART
transmembrane domain 280 302 N/A INTRINSIC
low complexity region 336 345 N/A INTRINSIC
TyrKc 386 662 4.38e-152 SMART
low complexity region 690 704 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120715
AA Change: R513*
SMART Domains Protein: ENSMUSP00000113474
Gene: ENSMUSG00000030849
AA Change: R513*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
TyrKc 369 645 4.38e-152 SMART
low complexity region 673 687 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121064
AA Change: R413*
SMART Domains Protein: ENSMUSP00000113452
Gene: ENSMUSG00000030849
AA Change: R413*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 134 1.9e-4 SMART
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
TyrKc 269 545 4.38e-152 SMART
low complexity region 573 587 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121080
AA Change: R511*
SMART Domains Protein: ENSMUSP00000112585
Gene: ENSMUSG00000030849
AA Change: R511*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 317 326 N/A INTRINSIC
TyrKc 367 643 4.38e-152 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122054
AA Change: R644*
SMART Domains Protein: ENSMUSP00000112430
Gene: ENSMUSG00000030849
AA Change: R644*

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
IGc2 288 368 7.41e-7 SMART
transmembrane domain 394 416 N/A INTRINSIC
low complexity region 450 459 N/A INTRINSIC
TyrKc 500 776 4.38e-152 SMART
low complexity region 804 818 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122448
AA Change: R509*
SMART Domains Protein: ENSMUSP00000113993
Gene: ENSMUSG00000030849
AA Change: R509*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147859
Predicted Effect probably benign
Transcript: ENSMUST00000153166
SMART Domains Protein: ENSMUSP00000120100
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
SCOP:d1ev2e1 269 311 1e-5 SMART
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for null mutations die as embryos. Isoform IIIb deficient mutants die at birth with defects in multiple organs and tissues. Isoform IIIc deficient mutants have defects in osteoblast and chondrocyte lineages, producing dwarfism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T A 2: 58,477,727 I141F probably benign Het
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adck1 C T 12: 88,431,150 Q185* probably null Het
Adgrb3 T C 1: 25,831,027 probably benign Het
Als2cl T C 9: 110,885,398 S105P probably damaging Het
Asns C A 6: 7,675,320 A561S probably benign Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Bst1 A T 5: 43,825,340 probably null Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Csmd3 G A 15: 47,899,795 T1215I possibly damaging Het
Csnk1e A T 15: 79,420,929 S323T probably benign Het
Cyp2j7 G T 4: 96,217,409 T288K probably benign Het
Dnaaf5 T A 5: 139,163,392 I482N probably damaging Het
Dpy19l3 A G 7: 35,692,859 I636T probably damaging Het
Enpep T G 3: 129,284,091 T626P possibly damaging Het
Gm14409 T G 2: 177,265,096 Q203P possibly damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpr83 T C 9: 14,864,838 Y152H probably damaging Het
Hdac7 T C 15: 97,807,715 E400G probably damaging Het
Hypk A T 2: 121,457,994 E82V probably damaging Het
Iqub C A 6: 24,505,868 A14S probably benign Het
Lias T C 5: 65,395,444 M130T probably damaging Het
Lingo4 T C 3: 94,402,897 S381P possibly damaging Het
Mdn1 A G 4: 32,704,635 T1536A probably damaging Het
Moxd2 T A 6: 40,884,062 D265V probably damaging Het
Mtbp C A 15: 55,603,215 S541R probably benign Het
Olfr1408 C A 1: 173,130,302 C305F probably benign Het
Olfr441 T C 6: 43,116,287 S182P probably benign Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Pcsk9 G T 4: 106,458,959 Q96K probably benign Het
Pramef17 T C 4: 143,991,622 Y417C probably damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Setd1a A G 7: 127,785,731 N585D possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Smarcal1 T C 1: 72,611,478 probably benign Het
Snx19 G T 9: 30,428,599 L344F probably benign Het
Srfbp1 T C 18: 52,488,331 C155R probably benign Het
Sspo C T 6: 48,487,353 R3914C probably damaging Het
Tacc2 G A 7: 130,623,541 S652N probably damaging Het
Tmub1 A C 5: 24,446,070 L197R probably damaging Het
Tnc T C 4: 64,007,829 T905A possibly damaging Het
Tnfrsf21 G T 17: 43,087,842 R613L possibly damaging Het
Ugt3a2 A T 15: 9,351,197 E97D probably benign Het
Vmn2r25 A G 6: 123,839,797 I275T probably benign Het
Zfp568 G T 7: 30,022,296 C221F probably benign Het
Zfp91 C A 19: 12,778,021 E217* probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Fgfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Fgfr2 APN 7 130167711 missense probably benign 0.45
IGL00594:Fgfr2 APN 7 130228723 missense probably damaging 1.00
IGL00963:Fgfr2 APN 7 130228761 missense probably damaging 0.99
IGL01968:Fgfr2 APN 7 130185248 missense probably damaging 1.00
IGL02003:Fgfr2 APN 7 130219072 missense probably damaging 1.00
IGL02063:Fgfr2 APN 7 130167755 missense probably damaging 1.00
IGL02239:Fgfr2 APN 7 130177686 missense probably damaging 1.00
IGL02349:Fgfr2 APN 7 130242606 missense probably damaging 1.00
IGL02630:Fgfr2 APN 7 130228795 splice site probably null
IGL02639:Fgfr2 APN 7 130228802 splice site probably benign
IGL03058:Fgfr2 APN 7 130182692 missense probably damaging 1.00
IGL03263:Fgfr2 APN 7 130180419 missense probably benign 0.12
IGL03377:Fgfr2 APN 7 130198517 missense probably damaging 0.98
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0078:Fgfr2 UTSW 7 130201075 missense possibly damaging 0.95
R0085:Fgfr2 UTSW 7 130196263 missense probably damaging 0.99
R0278:Fgfr2 UTSW 7 130261862 unclassified probably null
R0335:Fgfr2 UTSW 7 130196249 missense probably benign 0.00
R0557:Fgfr2 UTSW 7 130219081 missense probably damaging 1.00
R0631:Fgfr2 UTSW 7 130227239 intron probably benign
R0637:Fgfr2 UTSW 7 130171624 missense possibly damaging 0.89
R0841:Fgfr2 UTSW 7 130261905 missense probably benign 0.03
R0841:Fgfr2 UTSW 7 130772007 unclassified probably benign
R1646:Fgfr2 UTSW 7 130242644 missense probably damaging 1.00
R1670:Fgfr2 UTSW 7 130180457 missense probably damaging 1.00
R1678:Fgfr2 UTSW 7 130228620 splice site probably null
R1950:Fgfr2 UTSW 7 130198481 missense probably damaging 0.96
R2393:Fgfr2 UTSW 7 130227238 intron probably null
R3706:Fgfr2 UTSW 7 130198431 missense probably benign 0.31
R3717:Fgfr2 UTSW 7 130182757 missense probably damaging 1.00
R3808:Fgfr2 UTSW 7 130199848 missense probably benign 0.01
R3945:Fgfr2 UTSW 7 130177755 missense possibly damaging 0.71
R4718:Fgfr2 UTSW 7 130261788 missense probably damaging 1.00
R4779:Fgfr2 UTSW 7 130185193 intron probably benign
R4925:Fgfr2 UTSW 7 130185272 missense probably damaging 1.00
R4932:Fgfr2 UTSW 7 130241277 missense probably damaging 1.00
R4941:Fgfr2 UTSW 7 130198445 missense probably benign 0.21
R4980:Fgfr2 UTSW 7 130201080 missense probably damaging 1.00
R5304:Fgfr2 UTSW 7 130167774 missense probably damaging 1.00
R5313:Fgfr2 UTSW 7 130241240 missense probably benign 0.01
R5375:Fgfr2 UTSW 7 130241215 missense possibly damaging 0.65
R5652:Fgfr2 UTSW 7 130261863 missense probably damaging 1.00
R6120:Fgfr2 UTSW 7 130228690 missense probably benign 0.24
R6347:Fgfr2 UTSW 7 130261757 missense probably damaging 1.00
R6375:Fgfr2 UTSW 7 130167745 missense probably damaging 1.00
R6475:Fgfr2 UTSW 7 130201120 missense probably benign 0.03
R6481:Fgfr2 UTSW 7 130185278 missense possibly damaging 0.85
R6494:Fgfr2 UTSW 7 130198550 missense probably damaging 1.00
R6542:Fgfr2 UTSW 7 130201123 missense probably benign 0.02
X0024:Fgfr2 UTSW 7 130185329 missense probably damaging 0.99
Z1088:Fgfr2 UTSW 7 130169799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCACCAATAAACCTGTGTC -3'
(R):5'- ATTACCATGCCTTGTGGGAG -3'

Sequencing Primer
(F):5'- AAACCTGTGTCATTCATTCTGTAACC -3'
(R):5'- AGCCTCTTGTCGATGCTAGTCAG -3'
Posted On2015-07-21