Incidental Mutation 'R4439:Gm13084'
ID329664
Institutional Source Beutler Lab
Gene Symbol Gm13084
Ensembl Gene ENSMUSG00000059218
Gene Namepredicted gene 13084
Synonyms
MMRRC Submission 041704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4439 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143809245-143816093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143811573 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 276 (V276E)
Ref Sequence ENSEMBL: ENSMUSP00000074557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075045] [ENSMUST00000105769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075045
AA Change: V276E

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074557
Gene: ENSMUSG00000059218
AA Change: V276E

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 409 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105769
AA Change: V276E

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101395
Gene: ENSMUSG00000059218
AA Change: V276E

DomainStartEndE-ValueType
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137635
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb C T 5: 114,246,496 T2237I possibly damaging Het
Adgre1 T A 17: 57,447,954 L684Q probably damaging Het
Cfap157 T A 2: 32,777,865 Y488F probably benign Het
D630045J12Rik A G 6: 38,194,761 I824T probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Eno2 T C 6: 124,762,959 probably benign Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Garem2 G T 5: 30,113,346 V106L possibly damaging Het
Grk3 A T 5: 112,946,677 probably null Het
Hint2 T A 4: 43,654,919 Y70F probably damaging Het
Hist1h3b A T 13: 23,752,725 probably null Het
Ipp A G 4: 116,515,077 N101S probably benign Het
Kcnj1 A T 9: 32,394,118 probably benign Het
Kcnk4 T C 19: 6,932,761 D44G probably benign Het
Kif5c T C 2: 49,688,725 S122P possibly damaging Het
Nipbl T A 15: 8,338,724 K1171N probably damaging Het
Olfr1285 T A 2: 111,409,308 noncoding transcript Het
Pcf11 A C 7: 92,658,017 L981R probably damaging Het
Pias2 T A 18: 77,097,703 L153H probably damaging Het
Pjvk T C 2: 76,651,406 S68P probably damaging Het
Pkd1 T C 17: 24,585,692 V3130A probably damaging Het
Plpp4 C A 7: 129,257,089 probably benign Het
Plxnd1 T A 6: 115,993,976 H277L probably damaging Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rd3l C A 12: 111,979,658 S63I possibly damaging Het
Scfd2 G C 5: 74,397,707 A503G possibly damaging Het
Slco4a1 T C 2: 180,472,662 V549A probably benign Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tnrc6a A T 7: 123,152,182 K54* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpr T A 1: 150,403,961 D206E probably benign Het
Ugt2b34 A T 5: 86,892,867 F399I probably damaging Het
Usp3 A T 9: 66,518,494 D456E probably benign Het
Vmn1r60 T A 7: 5,544,489 H204L probably damaging Het
Vmn2r97 G T 17: 18,930,354 A488S probably benign Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr86 T C 5: 24,730,237 D36G probably damaging Het
Zc3h4 C T 7: 16,429,111 P479S unknown Het
Zfhx4 A T 3: 5,214,815 probably benign Het
Zfp607b T A 7: 27,702,724 C202S probably damaging Het
Zfp882 T A 8: 71,913,609 F93L probably damaging Het
Other mutations in Gm13084
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Gm13084 APN 4 143812723 missense probably benign 0.32
IGL01075:Gm13084 APN 4 143811646 missense possibly damaging 0.47
IGL02705:Gm13084 APN 4 143810802 missense probably damaging 1.00
IGL03011:Gm13084 APN 4 143811760 missense possibly damaging 0.95
PIT4498001:Gm13084 UTSW 4 143812836 missense possibly damaging 0.63
R0268:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0344:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0390:Gm13084 UTSW 4 143811699 missense probably benign 0.09
R0597:Gm13084 UTSW 4 143812652 missense probably damaging 0.98
R0646:Gm13084 UTSW 4 143812585 missense possibly damaging 0.83
R0927:Gm13084 UTSW 4 143812808 missense probably benign 0.05
R0973:Gm13084 UTSW 4 143811858 missense probably damaging 1.00
R1851:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R1852:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R3699:Gm13084 UTSW 4 143810352 missense probably benign 0.05
R3705:Gm13084 UTSW 4 143811775 missense probably benign 0.06
R3845:Gm13084 UTSW 4 143811975 missense probably damaging 0.96
R4035:Gm13084 UTSW 4 143810456 missense probably benign 0.08
R4044:Gm13084 UTSW 4 143811600 missense probably benign 0.34
R4660:Gm13084 UTSW 4 143811865 missense probably benign 0.19
R4770:Gm13084 UTSW 4 143811949 missense probably damaging 0.96
R4838:Gm13084 UTSW 4 143810805 nonsense probably null
R5534:Gm13084 UTSW 4 143812599 nonsense probably null
R5691:Gm13084 UTSW 4 143812009 missense probably benign 0.44
R5893:Gm13084 UTSW 4 143810468 missense probably damaging 1.00
R6123:Gm13084 UTSW 4 143812764 missense possibly damaging 0.89
R6285:Gm13084 UTSW 4 143816039 missense probably damaging 1.00
R6886:Gm13084 UTSW 4 143812762 missense probably benign 0.29
R7105:Gm13084 UTSW 4 143810771 missense probably benign 0.04
R7135:Gm13084 UTSW 4 143810663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGACCATCGTGGACTAC -3'
(R):5'- CAAAGCCACAGTCATAGAAATGTTC -3'

Sequencing Primer
(F):5'- GGACTACCAAGATTGTAAAACAAAGC -3'
(R):5'- AGAAATGTTCAAAATTGTACATGCAG -3'
Posted On2015-07-21