Incidental Mutation 'R4439:D630045J12Rik'
ID329670
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission 041704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4439 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38194761 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 824 (I824T)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
Predicted Effect probably benign
Transcript: ENSMUST00000117556
AA Change: I683T

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: I683T

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149557
Predicted Effect probably benign
Transcript: ENSMUST00000169256
AA Change: I824T

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: I824T

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb C T 5: 114,246,496 T2237I possibly damaging Het
Adgre1 T A 17: 57,447,954 L684Q probably damaging Het
Cfap157 T A 2: 32,777,865 Y488F probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Eno2 T C 6: 124,762,959 probably benign Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Garem2 G T 5: 30,113,346 V106L possibly damaging Het
Gm13084 A T 4: 143,811,573 V276E possibly damaging Het
Grk3 A T 5: 112,946,677 probably null Het
Hint2 T A 4: 43,654,919 Y70F probably damaging Het
Hist1h3b A T 13: 23,752,725 probably null Het
Ipp A G 4: 116,515,077 N101S probably benign Het
Kcnj1 A T 9: 32,394,118 probably benign Het
Kcnk4 T C 19: 6,932,761 D44G probably benign Het
Kif5c T C 2: 49,688,725 S122P possibly damaging Het
Nipbl T A 15: 8,338,724 K1171N probably damaging Het
Olfr1285 T A 2: 111,409,308 noncoding transcript Het
Pcf11 A C 7: 92,658,017 L981R probably damaging Het
Pias2 T A 18: 77,097,703 L153H probably damaging Het
Pjvk T C 2: 76,651,406 S68P probably damaging Het
Pkd1 T C 17: 24,585,692 V3130A probably damaging Het
Plpp4 C A 7: 129,257,089 probably benign Het
Plxnd1 T A 6: 115,993,976 H277L probably damaging Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rd3l C A 12: 111,979,658 S63I possibly damaging Het
Scfd2 G C 5: 74,397,707 A503G possibly damaging Het
Slco4a1 T C 2: 180,472,662 V549A probably benign Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tnrc6a A T 7: 123,152,182 K54* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpr T A 1: 150,403,961 D206E probably benign Het
Ugt2b34 A T 5: 86,892,867 F399I probably damaging Het
Usp3 A T 9: 66,518,494 D456E probably benign Het
Vmn1r60 T A 7: 5,544,489 H204L probably damaging Het
Vmn2r97 G T 17: 18,930,354 A488S probably benign Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr86 T C 5: 24,730,237 D36G probably damaging Het
Zc3h4 C T 7: 16,429,111 P479S unknown Het
Zfhx4 A T 3: 5,214,815 probably benign Het
Zfp607b T A 7: 27,702,724 C202S probably damaging Het
Zfp882 T A 8: 71,913,609 F93L probably damaging Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38178839 missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38195101 missense probably benign
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38190655 missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38174147 critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38194485 missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38148543 missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38194620 missense probably benign
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38190617 missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R6930:D630045J12Rik UTSW 6 38158216 missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGAGGGTTCTGACTCATAGGCTC -3'
(R):5'- GGACTCACCTCACATCACTG -3'

Sequencing Primer
(F):5'- TGTTCAGAGCAGAGTCCACAGTATC -3'
(R):5'- GCCAACAACTGTTTTCCATTTGACAC -3'
Posted On2015-07-21