Incidental Mutation 'R4439:Tnrc6a'
ID329679
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Nametrinucleotide repeat containing 6a
SynonymsCAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik
MMRRC Submission 041704-MU
Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R4439 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location123123885-123195296 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 123152182 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 54 (K54*)
Ref Sequence ENSEMBL: ENSMUSP00000091595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206888]
Predicted Effect probably null
Transcript: ENSMUST00000094053
AA Change: K54*
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: K54*

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206458
Predicted Effect probably benign
Transcript: ENSMUST00000206888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211170
Meta Mutation Damage Score 0.594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb C T 5: 114,246,496 T2237I possibly damaging Het
Adgre1 T A 17: 57,447,954 L684Q probably damaging Het
Cfap157 T A 2: 32,777,865 Y488F probably benign Het
D630045J12Rik A G 6: 38,194,761 I824T probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Eno2 T C 6: 124,762,959 probably benign Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Garem2 G T 5: 30,113,346 V106L possibly damaging Het
Gm13084 A T 4: 143,811,573 V276E possibly damaging Het
Grk3 A T 5: 112,946,677 probably null Het
Hint2 T A 4: 43,654,919 Y70F probably damaging Het
Hist1h3b A T 13: 23,752,725 probably null Het
Ipp A G 4: 116,515,077 N101S probably benign Het
Kcnj1 A T 9: 32,394,118 probably benign Het
Kcnk4 T C 19: 6,932,761 D44G probably benign Het
Kif5c T C 2: 49,688,725 S122P possibly damaging Het
Nipbl T A 15: 8,338,724 K1171N probably damaging Het
Olfr1285 T A 2: 111,409,308 noncoding transcript Het
Pcf11 A C 7: 92,658,017 L981R probably damaging Het
Pias2 T A 18: 77,097,703 L153H probably damaging Het
Pjvk T C 2: 76,651,406 S68P probably damaging Het
Pkd1 T C 17: 24,585,692 V3130A probably damaging Het
Plpp4 C A 7: 129,257,089 probably benign Het
Plxnd1 T A 6: 115,993,976 H277L probably damaging Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rd3l C A 12: 111,979,658 S63I possibly damaging Het
Scfd2 G C 5: 74,397,707 A503G possibly damaging Het
Slco4a1 T C 2: 180,472,662 V549A probably benign Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpr T A 1: 150,403,961 D206E probably benign Het
Ugt2b34 A T 5: 86,892,867 F399I probably damaging Het
Usp3 A T 9: 66,518,494 D456E probably benign Het
Vmn1r60 T A 7: 5,544,489 H204L probably damaging Het
Vmn2r97 G T 17: 18,930,354 A488S probably benign Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr86 T C 5: 24,730,237 D36G probably damaging Het
Zc3h4 C T 7: 16,429,111 P479S unknown Het
Zfhx4 A T 3: 5,214,815 probably benign Het
Zfp607b T A 7: 27,702,724 C202S probably damaging Het
Zfp882 T A 8: 71,913,609 F93L probably damaging Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 123170780 missense probably benign 0.04
IGL00580:Tnrc6a APN 7 123174278 missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 123171494 missense probably benign 0.04
IGL02004:Tnrc6a APN 7 123181366 missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 123152191 intron probably benign
IGL02220:Tnrc6a APN 7 123170456 missense probably benign
IGL02436:Tnrc6a APN 7 123184215 nonsense probably null
IGL02670:Tnrc6a APN 7 123171312 missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 123171473 missense probably damaging 1.00
0152:Tnrc6a UTSW 7 123180654 missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0369:Tnrc6a UTSW 7 123170860 missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 123186728 splice site probably benign
R0566:Tnrc6a UTSW 7 123170913 missense probably benign 0.00
R0600:Tnrc6a UTSW 7 123171816 missense probably benign 0.14
R0751:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 123184251 missense probably benign 0.02
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 123176875 missense probably benign 0.08
R1709:Tnrc6a UTSW 7 123169982 missense probably benign 0.10
R1776:Tnrc6a UTSW 7 123171297 missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 123192917 missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 123162446 splice site probably benign
R1876:Tnrc6a UTSW 7 123162446 splice site probably benign
R2010:Tnrc6a UTSW 7 123171046 missense probably benign 0.26
R2086:Tnrc6a UTSW 7 123162446 splice site probably benign
R2089:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2511:Tnrc6a UTSW 7 123171092 missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 123192949 makesense probably null
R2850:Tnrc6a UTSW 7 123179800 missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 123181384 missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 123170121 missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 123171680 missense probably benign 0.00
R4525:Tnrc6a UTSW 7 123179782 missense probably benign
R4578:Tnrc6a UTSW 7 123184221 missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 123184289 critical splice donor site probably null
R4711:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 123192090 missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 123189997 missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 123169911 missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 123192613 missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 123189872 missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 123186723 critical splice donor site probably null
R5239:Tnrc6a UTSW 7 123186619 missense probably benign
R5604:Tnrc6a UTSW 7 123174236 missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 123170076 missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 123186665 missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 123182380 missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 123143742 splice site probably null
R6284:Tnrc6a UTSW 7 123171335 missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6420:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6575:Tnrc6a UTSW 7 123169910 missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 123171999 missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 123187445 missense probably benign 0.17
R6968:Tnrc6a UTSW 7 123182427 missense probably benign 0.05
R7216:Tnrc6a UTSW 7 123171495 missense probably benign 0.01
R7260:Tnrc6a UTSW 7 123186590 missense probably benign 0.36
R7299:Tnrc6a UTSW 7 123170913 missense probably benign
R7322:Tnrc6a UTSW 7 123171508 missense probably benign 0.09
X0064:Tnrc6a UTSW 7 123169798 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AACAATGGGGCACATCTGTAG -3'
(R):5'- GACAGCATCTTCTCCATGTGG -3'

Sequencing Primer
(F):5'- CTGTAGGAAAAGAATGCTTGCATGTC -3'
(R):5'- CCCATCCTGAAGGTGAAT -3'
Posted On2015-07-21