Incidental Mutation 'R4440:Rasgrf2'
ID329734
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene NameRAS protein-specific guanine nucleotide-releasing factor 2
SynonymsGrf2, 6330417G04Rik
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R4440 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91880400-92131656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91983678 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 620 (D620G)
Ref Sequence ENSEMBL: ENSMUSP00000096930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099326
AA Change: D620G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: D620G

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142378
AA Change: D19G
SMART Domains Protein: ENSMUSP00000115401
Gene: ENSMUSG00000021708
AA Change: D19G

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
Blast:RasGEFN 187 249 8e-29 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000151408
AA Change: D19G
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: D19G

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 A G 7: 49,575,263 probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 91982654 missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 91885654 nonsense probably null
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 91983661 missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 91919892 missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92030853 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 91983613 missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 91982833 missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92022592 intron probably benign
R7056:Rasgrf2 UTSW 13 92030695 missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 91886402 missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 91884518 nonsense probably null
R7392:Rasgrf2 UTSW 13 91893737 missense
R7469:Rasgrf2 UTSW 13 92029022 critical splice donor site probably null
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTGAGAGCTTTGCCAG -3'
(R):5'- AGAATGTCCTGGTGGTACATGG -3'

Sequencing Primer
(F):5'- TTTGCCAGCACTACGGTG -3'
(R):5'- CCTGGTGGTACATGGTGTCCC -3'
Posted On2015-07-21