Incidental Mutation 'R4441:Gm12790'
ID329757
Institutional Source Beutler Lab
Gene Symbol Gm12790
Ensembl Gene ENSMUSG00000078626
Gene Namepredicted gene 12790
Synonyms
MMRRC Submission 041706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4441 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location101967453-101981049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101968140 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 26 (S26A)
Ref Sequence ENSEMBL: ENSMUSP00000102529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106916]
Predicted Effect probably damaging
Transcript: ENSMUST00000106916
AA Change: S26A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102529
Gene: ENSMUSG00000078626
AA Change: S26A

DomainStartEndE-ValueType
low complexity region 131 136 N/A INTRINSIC
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,801 R1238S probably benign Het
Ankmy1 A T 1: 92,888,661 Y244N possibly damaging Het
Asxl3 C T 18: 22,524,233 P1767S probably damaging Het
C1qtnf7 A T 5: 43,609,270 K70N possibly damaging Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fam92a A G 4: 12,157,733 M261T probably damaging Het
Garem1 T C 18: 21,168,750 T127A possibly damaging Het
Gls A T 1: 52,196,163 probably null Het
Gm136 T C 4: 34,755,911 D34G probably benign Het
Gmds A G 13: 31,940,478 probably null Het
Hdac9 G T 12: 34,389,376 H401N probably damaging Het
Hmcn1 T C 1: 150,657,459 I3026V probably null Het
Igkv6-20 A T 6: 70,336,117 M24K probably damaging Het
Ilf2 T C 3: 90,487,462 L339P probably benign Het
Insr T A 8: 3,194,902 K501N probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcm5 T C 8: 75,112,544 S142P probably benign Het
Mcpt9 A G 14: 56,027,552 V164A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nfia T C 4: 97,772,913 probably null Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Olfr1346 T C 7: 6,474,925 S272P probably benign Het
Olfr578 A T 7: 102,984,309 V285E possibly damaging Het
Olfr638 T G 7: 104,004,072 F266V probably damaging Het
Pcdhgb8 A G 18: 37,763,061 I395V possibly damaging Het
Plcz1 T A 6: 139,990,687 L605F probably benign Het
Prph G A 15: 99,057,124 S325N probably damaging Het
Ptpn23 A G 9: 110,392,725 M131T probably benign Het
Rab3ip T G 10: 116,915,932 D278A probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rbm5 A G 9: 107,749,688 probably benign Het
Rc3h2 A G 2: 37,414,514 probably null Het
Tbxa2r T C 10: 81,333,091 S205P probably damaging Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tex45 C T 8: 3,476,105 S86L probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnik A G 3: 28,564,097 I266V possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 A G 7: 64,201,918 D12G probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr7 T A 18: 63,755,210 Y585N probably damaging Het
Zgrf1 T A 3: 127,586,137 N223K possibly damaging Het
Other mutations in Gm12790
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02286:Gm12790 APN 4 101967721 missense probably benign 0.06
R0184:Gm12790 UTSW 4 101967614 nonsense probably null
R0217:Gm12790 UTSW 4 101968034 missense probably damaging 1.00
R1401:Gm12790 UTSW 4 101968199 missense probably benign 0.01
R1708:Gm12790 UTSW 4 101967977 missense possibly damaging 0.83
R2116:Gm12790 UTSW 4 101967651 missense possibly damaging 0.83
R4575:Gm12790 UTSW 4 101968127 missense probably benign 0.17
R4578:Gm12790 UTSW 4 101968127 missense probably benign 0.17
R5148:Gm12790 UTSW 4 101968071 missense possibly damaging 0.57
R5519:Gm12790 UTSW 4 101967691 missense probably benign 0.03
R6282:Gm12790 UTSW 4 101967516 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CACAGCCTGGAAGGTATCAAC -3'
(R):5'- AGCTTGCTCAGTCCCTGATC -3'

Sequencing Primer
(F):5'- TCAACATGGTAATAATCCATCAGGGG -3'
(R):5'- GTACACTACAGCTGTCATCGG -3'
Posted On2015-07-21