Incidental Mutation 'R4441:Olfr578'
ID329766
Institutional Source Beutler Lab
Gene Symbol Olfr578
Ensembl Gene ENSMUSG00000045792
Gene Nameolfactory receptor 578
SynonymsMOR7-1, GA_x6K02T2PBJ9-5696486-5695545
MMRRC Submission 041706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R4441 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102981608-102989324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102984309 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 285 (V285E)
Ref Sequence ENSEMBL: ENSMUSP00000149209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056235] [ENSMUST00000215606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056235
AA Change: V285E

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058167
Gene: ENSMUSG00000045792
AA Change: V285E

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 5e-130 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.6e-7 PFAM
Pfam:7tm_1 43 294 3.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215606
AA Change: V285E

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,801 R1238S probably benign Het
Ankmy1 A T 1: 92,888,661 Y244N possibly damaging Het
Asxl3 C T 18: 22,524,233 P1767S probably damaging Het
C1qtnf7 A T 5: 43,609,270 K70N possibly damaging Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fam92a A G 4: 12,157,733 M261T probably damaging Het
Garem1 T C 18: 21,168,750 T127A possibly damaging Het
Gls A T 1: 52,196,163 probably null Het
Gm12790 A C 4: 101,968,140 S26A probably damaging Het
Gm136 T C 4: 34,755,911 D34G probably benign Het
Gmds A G 13: 31,940,478 probably null Het
Hdac9 G T 12: 34,389,376 H401N probably damaging Het
Hmcn1 T C 1: 150,657,459 I3026V probably null Het
Igkv6-20 A T 6: 70,336,117 M24K probably damaging Het
Ilf2 T C 3: 90,487,462 L339P probably benign Het
Insr T A 8: 3,194,902 K501N probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcm5 T C 8: 75,112,544 S142P probably benign Het
Mcpt9 A G 14: 56,027,552 V164A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nfia T C 4: 97,772,913 probably null Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Olfr1346 T C 7: 6,474,925 S272P probably benign Het
Olfr638 T G 7: 104,004,072 F266V probably damaging Het
Pcdhgb8 A G 18: 37,763,061 I395V possibly damaging Het
Plcz1 T A 6: 139,990,687 L605F probably benign Het
Prph G A 15: 99,057,124 S325N probably damaging Het
Ptpn23 A G 9: 110,392,725 M131T probably benign Het
Rab3ip T G 10: 116,915,932 D278A probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rbm5 A G 9: 107,749,688 probably benign Het
Rc3h2 A G 2: 37,414,514 probably null Het
Tbxa2r T C 10: 81,333,091 S205P probably damaging Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tex45 C T 8: 3,476,105 S86L probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnik A G 3: 28,564,097 I266V possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 A G 7: 64,201,918 D12G probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr7 T A 18: 63,755,210 Y585N probably damaging Het
Zgrf1 T A 3: 127,586,137 N223K possibly damaging Het
Other mutations in Olfr578
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Olfr578 APN 7 102984702 missense probably damaging 0.97
IGL02658:Olfr578 APN 7 102984330 missense probably benign 0.00
R0833:Olfr578 UTSW 7 102984836 missense possibly damaging 0.50
R1470:Olfr578 UTSW 7 102984323 nonsense probably null
R1470:Olfr578 UTSW 7 102984323 nonsense probably null
R2029:Olfr578 UTSW 7 102984271 missense probably damaging 0.99
R2249:Olfr578 UTSW 7 102984440 missense possibly damaging 0.74
R2413:Olfr578 UTSW 7 102984802 missense probably damaging 1.00
R2898:Olfr578 UTSW 7 102984877 missense probably benign 0.19
R5696:Olfr578 UTSW 7 102984541 missense probably benign 0.02
R6810:Olfr578 UTSW 7 102984835 missense probably damaging 1.00
R7263:Olfr578 UTSW 7 102984317 nonsense probably null
R7366:Olfr578 UTSW 7 102984516 missense probably damaging 1.00
X0022:Olfr578 UTSW 7 102985026 missense probably benign 0.02
X0028:Olfr578 UTSW 7 102984343 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCATTGACCAGGGAAGATCAAAAG -3'
(R):5'- CCATGCTGTACTAGGCAAAGC -3'

Sequencing Primer
(F):5'- GAATTACTGTCAGACACCGTGCTAG -3'
(R):5'- GCAAAGCCTCCCGTCAG -3'
Posted On2015-07-21