Incidental Mutation 'R4441:Tle2'
ID329775
Institutional Source Beutler Lab
Gene Symbol Tle2
Ensembl Gene ENSMUSG00000034771
Gene Nametransducin-like enhancer of split 2
SynonymsGrg2
MMRRC Submission 041706-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R4441 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81574561-81590845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81581682 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 227 (E227G)
Ref Sequence ENSEMBL: ENSMUSP00000121125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135211] [ENSMUST00000136341] [ENSMUST00000143285] [ENSMUST00000146358] [ENSMUST00000146916]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129798
Predicted Effect probably benign
Transcript: ENSMUST00000135211
AA Change: E193G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117453
Gene: ENSMUSG00000034771
AA Change: E193G

DomainStartEndE-ValueType
Pfam:TLE_N 1 122 3e-68 PFAM
low complexity region 133 160 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
WD40 436 473 5.6e-3 SMART
WD40 479 520 9.6e-2 SMART
WD40 525 564 1.88e-4 SMART
WD40 567 606 3.72e-8 SMART
Blast:WD40 609 647 8e-18 BLAST
WD40 649 688 1.2e-2 SMART
WD40 689 729 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136254
Predicted Effect probably benign
Transcript: ENSMUST00000136341
SMART Domains Protein: ENSMUSP00000121585
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 121 1.3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140433
Predicted Effect probably benign
Transcript: ENSMUST00000143285
SMART Domains Protein: ENSMUSP00000122074
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 78 1.5e-49 PFAM
Pfam:TLE_N 76 114 1.3e-11 PFAM
low complexity region 124 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145878
Predicted Effect possibly damaging
Transcript: ENSMUST00000146358
AA Change: E227G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121125
Gene: ENSMUSG00000034771
AA Change: E227G

DomainStartEndE-ValueType
Pfam:TLE_N 1 64 2e-31 PFAM
Pfam:TLE_N 81 154 4.3e-34 PFAM
low complexity region 167 194 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
low complexity region 296 311 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
WD40 471 508 5.6e-3 SMART
WD40 514 555 9.6e-2 SMART
WD40 560 599 1.88e-4 SMART
WD40 602 641 3.72e-8 SMART
Blast:WD40 644 682 9e-18 BLAST
WD40 684 723 1.2e-2 SMART
WD40 724 764 2.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146916
AA Change: E204G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121173
Gene: ENSMUSG00000034771
AA Change: E204G

DomainStartEndE-ValueType
Pfam:TLE_N 1 134 1.6e-75 PFAM
low complexity region 144 171 N/A INTRINSIC
low complexity region 183 205 N/A INTRINSIC
low complexity region 273 288 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
WD40 435 472 5.6e-3 SMART
WD40 478 519 9.6e-2 SMART
WD40 524 563 1.88e-4 SMART
WD40 566 605 3.72e-8 SMART
WD40 648 687 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151470
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,801 R1238S probably benign Het
Ankmy1 A T 1: 92,888,661 Y244N possibly damaging Het
Asxl3 C T 18: 22,524,233 P1767S probably damaging Het
C1qtnf7 A T 5: 43,609,270 K70N possibly damaging Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fam92a A G 4: 12,157,733 M261T probably damaging Het
Garem1 T C 18: 21,168,750 T127A possibly damaging Het
Gls A T 1: 52,196,163 probably null Het
Gm12790 A C 4: 101,968,140 S26A probably damaging Het
Gm136 T C 4: 34,755,911 D34G probably benign Het
Gmds A G 13: 31,940,478 probably null Het
Hdac9 G T 12: 34,389,376 H401N probably damaging Het
Hmcn1 T C 1: 150,657,459 I3026V probably null Het
Igkv6-20 A T 6: 70,336,117 M24K probably damaging Het
Ilf2 T C 3: 90,487,462 L339P probably benign Het
Insr T A 8: 3,194,902 K501N probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcm5 T C 8: 75,112,544 S142P probably benign Het
Mcpt9 A G 14: 56,027,552 V164A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nfia T C 4: 97,772,913 probably null Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Olfr1346 T C 7: 6,474,925 S272P probably benign Het
Olfr578 A T 7: 102,984,309 V285E possibly damaging Het
Olfr638 T G 7: 104,004,072 F266V probably damaging Het
Pcdhgb8 A G 18: 37,763,061 I395V possibly damaging Het
Plcz1 T A 6: 139,990,687 L605F probably benign Het
Prph G A 15: 99,057,124 S325N probably damaging Het
Ptpn23 A G 9: 110,392,725 M131T probably benign Het
Rab3ip T G 10: 116,915,932 D278A probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rbm5 A G 9: 107,749,688 probably benign Het
Rc3h2 A G 2: 37,414,514 probably null Het
Tbxa2r T C 10: 81,333,091 S205P probably damaging Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tex45 C T 8: 3,476,105 S86L probably damaging Het
Tnik A G 3: 28,564,097 I266V possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 A G 7: 64,201,918 D12G probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr7 T A 18: 63,755,210 Y585N probably damaging Het
Zgrf1 T A 3: 127,586,137 N223K possibly damaging Het
Other mutations in Tle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Tle2 APN 10 81581739 missense probably benign 0.12
IGL02651:Tle2 APN 10 81586889 missense probably damaging 1.00
IGL02809:Tle2 APN 10 81586362 unclassified probably null
IGL03235:Tle2 APN 10 81586251 missense probably benign 0.22
IGL03307:Tle2 APN 10 81590240 missense probably damaging 1.00
PIT4515001:Tle2 UTSW 10 81587130 missense possibly damaging 0.72
R0394:Tle2 UTSW 10 81577648 missense probably damaging 1.00
R0744:Tle2 UTSW 10 81588947 missense probably damaging 1.00
R0826:Tle2 UTSW 10 81586314 missense possibly damaging 0.95
R0833:Tle2 UTSW 10 81588947 missense probably damaging 1.00
R1796:Tle2 UTSW 10 81589497 critical splice donor site probably null
R2067:Tle2 UTSW 10 81580551 missense probably damaging 1.00
R2184:Tle2 UTSW 10 81590277 missense probably damaging 1.00
R2198:Tle2 UTSW 10 81590313 missense probably damaging 1.00
R4439:Tle2 UTSW 10 81581682 missense possibly damaging 0.62
R4440:Tle2 UTSW 10 81581682 missense possibly damaging 0.62
R4513:Tle2 UTSW 10 81587560 missense probably damaging 1.00
R4839:Tle2 UTSW 10 81577684 missense probably damaging 1.00
R4863:Tle2 UTSW 10 81588891 missense possibly damaging 0.88
R5011:Tle2 UTSW 10 81584697 missense probably damaging 1.00
R5505:Tle2 UTSW 10 81581740 missense probably benign 0.00
R5538:Tle2 UTSW 10 81580584 missense probably damaging 1.00
R5790:Tle2 UTSW 10 81590315 missense probably damaging 1.00
R5917:Tle2 UTSW 10 81580916 critical splice donor site probably null
R6176:Tle2 UTSW 10 81587334 missense probably damaging 0.99
R6200:Tle2 UTSW 10 81588872 missense probably damaging 1.00
R6914:Tle2 UTSW 10 81586356 missense probably damaging 1.00
T0970:Tle2 UTSW 10 81580285 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACTCTATTAGCTGACAGAGGCAGAG -3'
(R):5'- AGCACCATGGACACAGTTCC -3'

Sequencing Primer
(F):5'- GTAGAGCCCTGCCTAGAATCCTAG -3'
(R):5'- TGGACACAGTTCCCATGGATC -3'
Posted On2015-07-21