Incidental Mutation 'R4441:Asxl3'
ID329787
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Nameadditional sex combs like 3, transcriptional regulator
SynonymsD930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik
MMRRC Submission 041706-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R4441 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location22344883-22530227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22524233 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1767 (P1767S)
Ref Sequence ENSEMBL: ENSMUSP00000112793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]
Predicted Effect probably damaging
Transcript: ENSMUST00000097655
AA Change: P1767S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: P1767S

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120223
AA Change: P1767S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: P1767S

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 179 304 1.3e-36 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2138 2202 1.9e-24 PFAM
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,801 R1238S probably benign Het
Ankmy1 A T 1: 92,888,661 Y244N possibly damaging Het
C1qtnf7 A T 5: 43,609,270 K70N possibly damaging Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fam92a A G 4: 12,157,733 M261T probably damaging Het
Garem1 T C 18: 21,168,750 T127A possibly damaging Het
Gls A T 1: 52,196,163 probably null Het
Gm12790 A C 4: 101,968,140 S26A probably damaging Het
Gm136 T C 4: 34,755,911 D34G probably benign Het
Gmds A G 13: 31,940,478 probably null Het
Hdac9 G T 12: 34,389,376 H401N probably damaging Het
Hmcn1 T C 1: 150,657,459 I3026V probably null Het
Igkv6-20 A T 6: 70,336,117 M24K probably damaging Het
Ilf2 T C 3: 90,487,462 L339P probably benign Het
Insr T A 8: 3,194,902 K501N probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcm5 T C 8: 75,112,544 S142P probably benign Het
Mcpt9 A G 14: 56,027,552 V164A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nfia T C 4: 97,772,913 probably null Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Olfr1346 T C 7: 6,474,925 S272P probably benign Het
Olfr578 A T 7: 102,984,309 V285E possibly damaging Het
Olfr638 T G 7: 104,004,072 F266V probably damaging Het
Pcdhgb8 A G 18: 37,763,061 I395V possibly damaging Het
Plcz1 T A 6: 139,990,687 L605F probably benign Het
Prph G A 15: 99,057,124 S325N probably damaging Het
Ptpn23 A G 9: 110,392,725 M131T probably benign Het
Rab3ip T G 10: 116,915,932 D278A probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rbm5 A G 9: 107,749,688 probably benign Het
Rc3h2 A G 2: 37,414,514 probably null Het
Tbxa2r T C 10: 81,333,091 S205P probably damaging Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tex45 C T 8: 3,476,105 S86L probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnik A G 3: 28,564,097 I266V possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 A G 7: 64,201,918 D12G probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr7 T A 18: 63,755,210 Y585N probably damaging Het
Zgrf1 T A 3: 127,586,137 N223K possibly damaging Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22525223 missense probably benign 0.41
IGL00510:Asxl3 APN 18 22523565 missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22522446 missense probably benign 0.06
IGL01074:Asxl3 APN 18 22522845 missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22516446 missense probably benign 0.06
IGL01313:Asxl3 APN 18 22517459 missense probably benign 0.41
IGL01349:Asxl3 APN 18 22524237 missense probably benign 0.28
IGL01529:Asxl3 APN 18 22517655 missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22523564 missense probably benign 0.06
IGL01583:Asxl3 APN 18 22516597 missense probably benign 0.01
IGL01619:Asxl3 APN 18 22523328 missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22525325 missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22522488 missense probably benign 0.10
IGL01828:Asxl3 APN 18 22525558 utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22434576 missense probably benign 0.00
IGL01906:Asxl3 APN 18 22522281 missense probably benign 0.01
IGL01962:Asxl3 APN 18 22522445 missense probably benign 0.00
IGL01991:Asxl3 APN 18 22516162 missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22524344 missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22524978 missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22453626 missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22522453 missense probably benign 0.01
IGL02478:Asxl3 APN 18 22523013 missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22452399 missense probably benign 0.19
IGL02660:Asxl3 APN 18 22524345 missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22524661 missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22523484 missense probably benign 0.01
IGL03001:Asxl3 APN 18 22517398 missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22522974 missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22516446 missense probably benign 0.06
R0145:Asxl3 UTSW 18 22453605 missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22523154 missense probably benign
R0207:Asxl3 UTSW 18 22411496 splice site probably benign
R0230:Asxl3 UTSW 18 22452326 splice site probably benign
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22517611 missense probably benign 0.00
R0519:Asxl3 UTSW 18 22523520 missense possibly damaging 0.85
R0520:Asxl3 UTSW 18 22522986 missense probably damaging 0.96
R0548:Asxl3 UTSW 18 22521792 splice site probably benign
R0626:Asxl3 UTSW 18 22522880 missense probably benign 0.02
R0711:Asxl3 UTSW 18 22524451 missense probably benign 0.01
R0744:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22525049 missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22524507 missense probably benign 0.00
R1372:Asxl3 UTSW 18 22410009 missense probably benign 0.00
R1440:Asxl3 UTSW 18 22525224 missense probably benign 0.13
R1463:Asxl3 UTSW 18 22516753 missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22516354 missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22516987 missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22452435 missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22522068 missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22517739 missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22452363 missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22523451 missense probably benign 0.02
R2174:Asxl3 UTSW 18 22453644 missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22516595 missense probably benign
R2443:Asxl3 UTSW 18 22411539 missense probably benign 0.12
R2907:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R4246:Asxl3 UTSW 18 22525500 missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22524366 missense possibly damaging 0.58
R4660:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4661:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4674:Asxl3 UTSW 18 22517738 missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22516769 missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22525454 missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22523312 missense probably benign 0.06
R5062:Asxl3 UTSW 18 22522718 missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22516019 missense probably benign 0.00
R5065:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22516708 missense probably damaging 1.00
R5174:Asxl3 UTSW 18 22523115 missense probably benign 0.45
R5183:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5294:Asxl3 UTSW 18 22516439 missense possibly damaging 0.77
R5416:Asxl3 UTSW 18 22524494 missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22525247 missense probably benign 0.28
R5873:Asxl3 UTSW 18 22516085 missense probably benign 0.04
R6240:Asxl3 UTSW 18 22465508 missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22522782 missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22516340 missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22517077 nonsense probably null
R6704:Asxl3 UTSW 18 22517305 missense probably benign 0.00
R6706:Asxl3 UTSW 18 22453609 missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22525440 missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22465400 nonsense probably null
R6811:Asxl3 UTSW 18 22522911 missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22523580 missense probably benign 0.00
R6830:Asxl3 UTSW 18 22525388 missense probably benign 0.45
R6957:Asxl3 UTSW 18 22522091 missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22523921 missense probably benign 0.00
R7058:Asxl3 UTSW 18 22517674 missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22517701 nonsense probably null
R7135:Asxl3 UTSW 18 22517702 missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22411499 critical splice acceptor site probably null
R7231:Asxl3 UTSW 18 22517540 missense probably damaging 1.00
Z1088:Asxl3 UTSW 18 22516772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAAGCTAATAACCCACTGG -3'
(R):5'- CCGTTCCTGCTTAAATGGCTG -3'

Sequencing Primer
(F):5'- ACTGGTGACACAGCTACTGCAG -3'
(R):5'- CTGGTTGTGTCCTAGCTGACTC -3'
Posted On2015-07-21