Incidental Mutation 'R4457:Fam227b'
ID329931
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Namefamily with sequence similarity 227, member B
Synonyms4930525F21Rik
MMRRC Submission 041717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4457 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125983483-126152004 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 126146268 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
Predicted Effect probably benign
Transcript: ENSMUST00000110446
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110448
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably benign
Transcript: ENSMUST00000178118
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (62/64)
MGI Phenotype Mice homozygous for a knock-out allele exhibit abnormal coat appearance, abnormal kidney morphology, spleen hypoplasia, decreased vesicles clustering in GABAergic synapses, decreased miniature inhibitory postsynaptic currents, and increased susceptibility to drug-induced seizures.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A G 16: 90,554,372 noncoding transcript Het
1700025G04Rik T C 1: 151,921,054 R87G probably damaging Het
9030619P08Rik T A 15: 75,431,400 noncoding transcript Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Arhgef5 T C 6: 43,274,093 S593P probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cfap73 T C 5: 120,630,150 K181R possibly damaging Het
Chn1 A G 2: 73,613,083 I383T probably damaging Het
Cmtr2 A G 8: 110,222,252 D398G probably benign Het
Dnah12 T C 14: 26,815,507 Y2238H probably damaging Het
Dnah7c A G 1: 46,740,621 N3161S probably damaging Het
Dnah8 C A 17: 30,813,151 H4148Q probably benign Het
Ehbp1l1 T C 19: 5,716,293 S397G possibly damaging Het
Eya4 A T 10: 23,116,668 S462R probably damaging Het
Frrs1 G A 3: 116,896,728 V7I probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gja10 A T 4: 32,601,073 M437K probably benign Het
Gm2840 T G 5: 96,174,328 noncoding transcript Het
Gm4956 A G 1: 21,298,095 noncoding transcript Het
Gria4 A G 9: 4,427,074 W789R probably damaging Het
Hoxb5 A G 11: 96,303,720 D36G probably damaging Het
Hps5 A T 7: 46,783,613 C228S probably benign Het
Hspa4 A T 11: 53,280,568 C270S probably damaging Het
Htra4 C A 8: 25,038,658 A73S possibly damaging Het
Ikzf2 T C 1: 69,684,188 probably benign Het
Ivl G A 3: 92,572,366 H131Y probably benign Het
Kat6a A G 8: 22,932,113 probably null Het
Lamp3 T A 16: 19,673,529 M322L probably benign Het
Letmd1 T C 15: 100,475,130 V37A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh1 G A 11: 67,220,615 G1627R probably benign Het
Myo9b A G 8: 71,290,999 I235V probably damaging Het
Ndor1 A G 2: 25,248,116 probably null Het
Ndufa12 A T 10: 94,220,818 K136M probably damaging Het
Olfr1174-ps A G 2: 88,310,829 probably benign Het
Olfr1251 A T 2: 89,667,083 S268T probably benign Het
Olfr331 A G 11: 58,502,118 L146P probably damaging Het
Olfr577 C T 7: 102,973,527 S155N probably damaging Het
Pcdha2 A G 18: 36,940,546 D410G probably damaging Het
Pcyox1l T A 18: 61,697,868 N311I probably benign Het
Pif1 A G 9: 65,587,776 probably benign Het
Pkp1 CTCTTCTT CTCTT 1: 135,875,624 probably null Het
Pogz G A 3: 94,856,063 V49I probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sgms2 A C 3: 131,325,016 Y273D probably damaging Het
Slc25a10 G A 11: 120,497,089 V203I probably benign Het
Slc4a2 T A 5: 24,434,330 probably benign Het
Tbc1d13 A G 2: 30,135,438 probably benign Het
Tdrd7 A G 4: 46,007,526 N526S probably benign Het
Tet2 C T 3: 133,485,563 D1037N possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Usp9y T A Y: 1,394,078 I551L possibly damaging Het
Vwde T C 6: 13,196,101 I308M probably damaging Het
Zan T C 5: 137,411,516 I3488V unknown Het
Zgrf1 A T 3: 127,595,929 I375F probably damaging Het
Zic4 A G 9: 91,379,262 K183R probably damaging Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 126144325 critical splice acceptor site probably null
IGL00970:Fam227b APN 2 126127060 missense probably benign 0.01
IGL02040:Fam227b APN 2 126121084 splice site probably benign
IGL02095:Fam227b APN 2 126101004 missense probably damaging 0.97
IGL02352:Fam227b APN 2 126146254 unclassified probably benign
IGL02359:Fam227b APN 2 126146254 unclassified probably benign
IGL02506:Fam227b APN 2 126003911 missense probably benign 0.22
IGL02717:Fam227b APN 2 126003843 missense probably null 0.97
IGL02933:Fam227b APN 2 126123988 splice site probably null
IGL03064:Fam227b APN 2 126126842 splice site probably null
IGL03086:Fam227b APN 2 126119031 missense probably benign 0.01
IGL03198:Fam227b APN 2 126124579 critical splice donor site probably null
IGL03256:Fam227b APN 2 125989003 missense probably damaging 0.99
IGL03368:Fam227b APN 2 126119063 missense probably damaging 1.00
dana UTSW 2 126116123 missense probably damaging 1.00
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0110:Fam227b UTSW 2 126100921 missense probably damaging 1.00
R0140:Fam227b UTSW 2 126124603 missense possibly damaging 0.53
R0377:Fam227b UTSW 2 126125000 splice site probably benign
R0499:Fam227b UTSW 2 126100909 missense probably benign 0.25
R1240:Fam227b UTSW 2 126124585 missense possibly damaging 0.56
R1356:Fam227b UTSW 2 126119008 missense probably damaging 1.00
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R2055:Fam227b UTSW 2 126100954 missense probably benign 0.13
R2884:Fam227b UTSW 2 126100926 missense probably benign 0.01
R3124:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3125:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3937:Fam227b UTSW 2 126127060 missense probably benign 0.01
R4408:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4454:Fam227b UTSW 2 126146268 unclassified probably benign
R4455:Fam227b UTSW 2 126146268 unclassified probably benign
R4558:Fam227b UTSW 2 126127043 missense probably benign 0.00
R4661:Fam227b UTSW 2 126007310 missense probably damaging 0.99
R4809:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125987939 missense probably benign 0.01
R4989:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5011:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5013:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5014:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5133:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5184:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5431:Fam227b UTSW 2 126126931 missense probably benign 0.09
R5797:Fam227b UTSW 2 126007334 missense probably benign
R6056:Fam227b UTSW 2 126121052 missense probably damaging 1.00
R6218:Fam227b UTSW 2 126126962 missense probably damaging 1.00
R6471:Fam227b UTSW 2 126121065 missense probably damaging 1.00
R6660:Fam227b UTSW 2 126144307 missense probably damaging 1.00
R6734:Fam227b UTSW 2 126126976 nonsense probably null
R7136:Fam227b UTSW 2 126124028 missense probably damaging 0.99
R7410:Fam227b UTSW 2 126119063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCCATGCAGGCTTCTC -3'
(R):5'- GCTCAGGTTCTGGAATTCAAAAC -3'

Sequencing Primer
(F):5'- GCTTCTCAGCACCAGGC -3'
(R):5'- CAGGTTCTGGAATTCAAAACTGTAAG -3'
Posted On2015-07-21