Incidental Mutation 'R4457:Zgrf1'
ID329935
Institutional Source Beutler Lab
Gene Symbol Zgrf1
Ensembl Gene ENSMUSG00000051278
Gene Namezinc finger, GRF-type containing 1
Synonyms4930422G04Rik
MMRRC Submission 041717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4457 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location127553489-127618023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127595929 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 375 (I375F)
Ref Sequence ENSEMBL: ENSMUSP00000143570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000196141] [ENSMUST00000196341] [ENSMUST00000199888] [ENSMUST00000200490]
Predicted Effect probably damaging
Transcript: ENSMUST00000043108
AA Change: I1259F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278
AA Change: I1259F

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196141
AA Change: I1259F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278
AA Change: I1259F

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196341
AA Change: I375F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143570
Gene: ENSMUSG00000051278
AA Change: I375F

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:zf-GRF 225 269 6.7e-15 PFAM
low complexity region 432 444 N/A INTRINSIC
Pfam:AAA_11 491 659 7.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197108
Predicted Effect probably benign
Transcript: ENSMUST00000199888
SMART Domains Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 3.5e-22 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200490
SMART Domains Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.4e-20 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Meta Mutation Damage Score 0.0436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A G 16: 90,554,372 noncoding transcript Het
1700025G04Rik T C 1: 151,921,054 R87G probably damaging Het
9030619P08Rik T A 15: 75,431,400 noncoding transcript Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Arhgef5 T C 6: 43,274,093 S593P probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cfap73 T C 5: 120,630,150 K181R possibly damaging Het
Chn1 A G 2: 73,613,083 I383T probably damaging Het
Cmtr2 A G 8: 110,222,252 D398G probably benign Het
Dnah12 T C 14: 26,815,507 Y2238H probably damaging Het
Dnah7c A G 1: 46,740,621 N3161S probably damaging Het
Dnah8 C A 17: 30,813,151 H4148Q probably benign Het
Ehbp1l1 T C 19: 5,716,293 S397G possibly damaging Het
Eya4 A T 10: 23,116,668 S462R probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Frrs1 G A 3: 116,896,728 V7I probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gja10 A T 4: 32,601,073 M437K probably benign Het
Gm2840 T G 5: 96,174,328 noncoding transcript Het
Gm4956 A G 1: 21,298,095 noncoding transcript Het
Gria4 A G 9: 4,427,074 W789R probably damaging Het
Hoxb5 A G 11: 96,303,720 D36G probably damaging Het
Hps5 A T 7: 46,783,613 C228S probably benign Het
Hspa4 A T 11: 53,280,568 C270S probably damaging Het
Htra4 C A 8: 25,038,658 A73S possibly damaging Het
Ikzf2 T C 1: 69,684,188 probably benign Het
Ivl G A 3: 92,572,366 H131Y probably benign Het
Kat6a A G 8: 22,932,113 probably null Het
Lamp3 T A 16: 19,673,529 M322L probably benign Het
Letmd1 T C 15: 100,475,130 V37A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh1 G A 11: 67,220,615 G1627R probably benign Het
Myo9b A G 8: 71,290,999 I235V probably damaging Het
Ndor1 A G 2: 25,248,116 probably null Het
Ndufa12 A T 10: 94,220,818 K136M probably damaging Het
Olfr1174-ps A G 2: 88,310,829 probably benign Het
Olfr1251 A T 2: 89,667,083 S268T probably benign Het
Olfr331 A G 11: 58,502,118 L146P probably damaging Het
Olfr577 C T 7: 102,973,527 S155N probably damaging Het
Pcdha2 A G 18: 36,940,546 D410G probably damaging Het
Pcyox1l T A 18: 61,697,868 N311I probably benign Het
Pif1 A G 9: 65,587,776 probably benign Het
Pkp1 CTCTTCTT CTCTT 1: 135,875,624 probably null Het
Pogz G A 3: 94,856,063 V49I probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sgms2 A C 3: 131,325,016 Y273D probably damaging Het
Slc25a10 G A 11: 120,497,089 V203I probably benign Het
Slc4a2 T A 5: 24,434,330 probably benign Het
Tbc1d13 A G 2: 30,135,438 probably benign Het
Tdrd7 A G 4: 46,007,526 N526S probably benign Het
Tet2 C T 3: 133,485,563 D1037N possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Usp9y T A Y: 1,394,078 I551L possibly damaging Het
Vwde T C 6: 13,196,101 I308M probably damaging Het
Zan T C 5: 137,411,516 I3488V unknown Het
Zic4 A G 9: 91,379,262 K183R probably damaging Het
Other mutations in Zgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Zgrf1 APN 3 127588141 splice site probably benign
IGL01153:Zgrf1 APN 3 127602406 missense probably damaging 1.00
IGL01330:Zgrf1 APN 3 127584007 missense probably damaging 1.00
IGL01501:Zgrf1 APN 3 127602562 splice site probably null
IGL01827:Zgrf1 APN 3 127616281 missense probably benign 0.06
IGL02600:Zgrf1 APN 3 127600974 splice site probably benign
IGL03122:Zgrf1 APN 3 127588133 missense possibly damaging 0.91
IGL03365:Zgrf1 APN 3 127598774 missense possibly damaging 0.48
R0015:Zgrf1 UTSW 3 127555397 splice site probably benign
R0243:Zgrf1 UTSW 3 127615446 missense probably damaging 0.99
R0468:Zgrf1 UTSW 3 127562041 missense possibly damaging 0.72
R0497:Zgrf1 UTSW 3 127584650 splice site probably benign
R0505:Zgrf1 UTSW 3 127573238 missense probably benign 0.30
R0511:Zgrf1 UTSW 3 127584660 missense possibly damaging 0.93
R0539:Zgrf1 UTSW 3 127615192 missense probably damaging 1.00
R0617:Zgrf1 UTSW 3 127588038 missense probably benign 0.39
R1298:Zgrf1 UTSW 3 127583889 missense possibly damaging 0.95
R1353:Zgrf1 UTSW 3 127611803 missense probably damaging 1.00
R1593:Zgrf1 UTSW 3 127561026 missense possibly damaging 0.86
R1846:Zgrf1 UTSW 3 127615463 missense probably damaging 1.00
R1912:Zgrf1 UTSW 3 127563137 missense probably benign
R2062:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2064:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2065:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2066:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2067:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2256:Zgrf1 UTSW 3 127561997 missense probably benign 0.18
R2321:Zgrf1 UTSW 3 127562407 nonsense probably null
R2381:Zgrf1 UTSW 3 127556214 missense probably benign 0.02
R2913:Zgrf1 UTSW 3 127598707 missense possibly damaging 0.65
R3147:Zgrf1 UTSW 3 127584148 missense possibly damaging 0.84
R3236:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R3237:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R4433:Zgrf1 UTSW 3 127562078 missense probably benign
R4441:Zgrf1 UTSW 3 127586137 missense possibly damaging 0.45
R4498:Zgrf1 UTSW 3 127586100 nonsense probably null
R4598:Zgrf1 UTSW 3 127601030 missense probably benign 0.14
R4701:Zgrf1 UTSW 3 127598704 missense probably benign 0.03
R4898:Zgrf1 UTSW 3 127602436 missense probably damaging 1.00
R4944:Zgrf1 UTSW 3 127561868 nonsense probably null
R5256:Zgrf1 UTSW 3 127602445 missense probably damaging 1.00
R5294:Zgrf1 UTSW 3 127600980 missense probably benign 0.14
R5358:Zgrf1 UTSW 3 127567703 critical splice donor site probably null
R5359:Zgrf1 UTSW 3 127601165 missense possibly damaging 0.95
R5447:Zgrf1 UTSW 3 127563119 missense possibly damaging 0.73
R5569:Zgrf1 UTSW 3 127561025 missense probably benign 0.33
R5887:Zgrf1 UTSW 3 127584765 missense probably damaging 1.00
R5914:Zgrf1 UTSW 3 127561023 missense probably damaging 0.99
R5925:Zgrf1 UTSW 3 127573204 missense possibly damaging 0.84
R5936:Zgrf1 UTSW 3 127562253 missense possibly damaging 0.72
R6087:Zgrf1 UTSW 3 127615486 missense probably damaging 1.00
R6089:Zgrf1 UTSW 3 127595993 missense probably damaging 1.00
R6181:Zgrf1 UTSW 3 127587941 missense probably damaging 1.00
R6277:Zgrf1 UTSW 3 127598812 missense possibly damaging 0.81
R6441:Zgrf1 UTSW 3 127588034 missense possibly damaging 0.93
R6659:Zgrf1 UTSW 3 127616506 missense probably damaging 0.99
R6857:Zgrf1 UTSW 3 127581447 missense probably damaging 0.99
R6932:Zgrf1 UTSW 3 127559632 critical splice donor site probably null
R7008:Zgrf1 UTSW 3 127561772 missense probably benign 0.18
R7175:Zgrf1 UTSW 3 127563590 missense probably damaging 1.00
R7264:Zgrf1 UTSW 3 127563569 missense probably benign 0.00
R7272:Zgrf1 UTSW 3 127598760 missense probably damaging 0.99
R7298:Zgrf1 UTSW 3 127583650 nonsense probably null
R7412:Zgrf1 UTSW 3 127563071 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGTAGAATGGGTCCATAAAGCAC -3'
(R):5'- AAACTGGAGATGGGTGCTTTTC -3'

Sequencing Primer
(F):5'- TGGGTCCATAAAGCACTAGATTCAG -3'
(R):5'- ACAATTCCACATACATCATTCTTGC -3'
Posted On2015-07-21