Incidental Mutation 'R4457:Sgms2'
ID329936
Institutional Source Beutler Lab
Gene Symbol Sgms2
Ensembl Gene ENSMUSG00000050931
Gene Namesphingomyelin synthase 2
Synonyms4933405A16Rik, 5133401H06Rik
MMRRC Submission 041717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R4457 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location131318985-131491411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 131325016 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 273 (Y273D)
Ref Sequence ENSEMBL: ENSMUSP00000087713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090246]
Predicted Effect probably damaging
Transcript: ENSMUST00000090246
AA Change: Y273D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087713
Gene: ENSMUSG00000050931
AA Change: Y273D

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:PAP2_C 220 293 5.5e-29 PFAM
Meta Mutation Damage Score 0.596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: Sphingomyelin, a major component of cell and Golgi membranes, is made by the transfer of phosphocholine from phosphatidylcholine onto ceramide, with diacylglycerol as a side product. The protein encoded by this gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The synthesis is reversible, and this enzyme can catalyze the reaction in either direction. The encoded protein is required for cell growth. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ceramide levels; decreased sphingomyelin, sphingomyelin-1-phosphate, and diacylglycerol levels; and resistance to lysenin-mediated cytolysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A G 16: 90,554,372 noncoding transcript Het
1700025G04Rik T C 1: 151,921,054 R87G probably damaging Het
9030619P08Rik T A 15: 75,431,400 noncoding transcript Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Arhgef5 T C 6: 43,274,093 S593P probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cfap73 T C 5: 120,630,150 K181R possibly damaging Het
Chn1 A G 2: 73,613,083 I383T probably damaging Het
Cmtr2 A G 8: 110,222,252 D398G probably benign Het
Dnah12 T C 14: 26,815,507 Y2238H probably damaging Het
Dnah7c A G 1: 46,740,621 N3161S probably damaging Het
Dnah8 C A 17: 30,813,151 H4148Q probably benign Het
Ehbp1l1 T C 19: 5,716,293 S397G possibly damaging Het
Eya4 A T 10: 23,116,668 S462R probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Frrs1 G A 3: 116,896,728 V7I probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gja10 A T 4: 32,601,073 M437K probably benign Het
Gm2840 T G 5: 96,174,328 noncoding transcript Het
Gm4956 A G 1: 21,298,095 noncoding transcript Het
Gria4 A G 9: 4,427,074 W789R probably damaging Het
Hoxb5 A G 11: 96,303,720 D36G probably damaging Het
Hps5 A T 7: 46,783,613 C228S probably benign Het
Hspa4 A T 11: 53,280,568 C270S probably damaging Het
Htra4 C A 8: 25,038,658 A73S possibly damaging Het
Ikzf2 T C 1: 69,684,188 probably benign Het
Ivl G A 3: 92,572,366 H131Y probably benign Het
Kat6a A G 8: 22,932,113 probably null Het
Lamp3 T A 16: 19,673,529 M322L probably benign Het
Letmd1 T C 15: 100,475,130 V37A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh1 G A 11: 67,220,615 G1627R probably benign Het
Myo9b A G 8: 71,290,999 I235V probably damaging Het
Ndor1 A G 2: 25,248,116 probably null Het
Ndufa12 A T 10: 94,220,818 K136M probably damaging Het
Olfr1174-ps A G 2: 88,310,829 probably benign Het
Olfr1251 A T 2: 89,667,083 S268T probably benign Het
Olfr331 A G 11: 58,502,118 L146P probably damaging Het
Olfr577 C T 7: 102,973,527 S155N probably damaging Het
Pcdha2 A G 18: 36,940,546 D410G probably damaging Het
Pcyox1l T A 18: 61,697,868 N311I probably benign Het
Pif1 A G 9: 65,587,776 probably benign Het
Pkp1 CTCTTCTT CTCTT 1: 135,875,624 probably null Het
Pogz G A 3: 94,856,063 V49I probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc25a10 G A 11: 120,497,089 V203I probably benign Het
Slc4a2 T A 5: 24,434,330 probably benign Het
Tbc1d13 A G 2: 30,135,438 probably benign Het
Tdrd7 A G 4: 46,007,526 N526S probably benign Het
Tet2 C T 3: 133,485,563 D1037N possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Usp9y T A Y: 1,394,078 I551L possibly damaging Het
Vwde T C 6: 13,196,101 I308M probably damaging Het
Zan T C 5: 137,411,516 I3488V unknown Het
Zgrf1 A T 3: 127,595,929 I375F probably damaging Het
Zic4 A G 9: 91,379,262 K183R probably damaging Het
Other mutations in Sgms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Sgms2 APN 3 131341833 missense possibly damaging 0.91
IGL01839:Sgms2 APN 3 131342102 missense possibly damaging 0.92
IGL02232:Sgms2 APN 3 131323184 missense probably benign
R0602:Sgms2 UTSW 3 131325107 critical splice acceptor site probably null
R2183:Sgms2 UTSW 3 131336285 splice site probably null
R4393:Sgms2 UTSW 3 131341817 unclassified probably null
R5050:Sgms2 UTSW 3 131330356 missense probably benign
R5052:Sgms2 UTSW 3 131330356 missense probably benign
R5088:Sgms2 UTSW 3 131330356 missense probably benign
R5224:Sgms2 UTSW 3 131342117 missense probably damaging 0.98
R5426:Sgms2 UTSW 3 131341797 missense probably benign 0.01
R5682:Sgms2 UTSW 3 131324962 missense probably damaging 0.99
R5735:Sgms2 UTSW 3 131336217 missense probably damaging 1.00
R6892:Sgms2 UTSW 3 131342154 missense probably benign
R7149:Sgms2 UTSW 3 131336259 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GTCCATCCCATGAAGCGATC -3'
(R):5'- ATGCTGGAGTAGTCTTAACTGAGAC -3'

Sequencing Primer
(F):5'- TCCCATGAAGCGATCTAACAC -3'
(R):5'- TAGCGTGCATAAGACCTTGGATTCC -3'
Posted On2015-07-21