Incidental Mutation 'R0047:Camk2g'
ID32994
Institutional Source Beutler Lab
Gene Symbol Camk2g
Ensembl Gene ENSMUSG00000021820
Gene Namecalcium/calmodulin-dependent protein kinase II gamma
SynonymsCaMK II, 5930429P18Rik, Camkg, Ca2+/calmodulin-dependent protein kinase II
MMRRC Submission 038341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0047 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location20734875-20794088 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 20771068 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071816] [ENSMUST00000080440] [ENSMUST00000100837] [ENSMUST00000226630]
Predicted Effect probably benign
Transcript: ENSMUST00000071816
SMART Domains Protein: ENSMUSP00000071720
Gene: ENSMUSG00000021820

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
low complexity region 323 338 N/A INTRINSIC
Pfam:CaMKII_AD 397 524 2.7e-62 PFAM
Pfam:DUF4440 401 514 3.9e-12 PFAM
Pfam:SnoaL_3 401 526 4.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080440
SMART Domains Protein: ENSMUSP00000079298
Gene: ENSMUSG00000021820

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 386 513 3.7e-63 PFAM
Pfam:DUF4440 390 504 3.2e-14 PFAM
Pfam:SnoaL_3 390 515 4.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100837
SMART Domains Protein: ENSMUSP00000098398
Gene: ENSMUSG00000021820

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 363 490 3.8e-63 PFAM
Pfam:DUF4440 367 481 3.6e-14 PFAM
Pfam:SnoaL_3 367 492 4.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225958
Predicted Effect probably benign
Transcript: ENSMUST00000226630
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is one of the four subunits of an enzyme which belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a gamma chain. Many alternatively spliced transcripts encoding different isoforms have been described but the full-length nature of all the variants has not been determined.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility and decreased sensitivity of macrophages to ER stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,264 T405A probably damaging Het
4932438A13Rik T A 3: 36,908,192 L481M possibly damaging Het
Acer1 A T 17: 56,955,624 D175E possibly damaging Het
Acsf2 T C 11: 94,569,342 I395V probably benign Het
Adamts9 G A 6: 92,905,306 probably benign Het
Amigo3 T C 9: 108,054,658 S427P probably benign Het
Ankrd35 A G 3: 96,684,063 K555R probably benign Het
Arhgap35 A T 7: 16,561,992 H1049Q probably benign Het
Arhgef5 G A 6: 43,265,621 probably null Het
Arid4a T G 12: 71,075,419 L858W probably damaging Het
Bbox1 A G 2: 110,268,302 F310S probably damaging Het
Bhlhe22 T C 3: 18,055,569 L261P probably damaging Het
Bmper T A 9: 23,406,686 C534S probably damaging Het
Cacna1d T G 14: 30,346,790 probably benign Het
Capn12 G A 7: 28,890,387 probably null Het
Cdkl4 T G 17: 80,550,845 N115T probably benign Het
Chchd1 T C 14: 20,704,163 S48P possibly damaging Het
Chia1 G T 3: 106,115,257 C49F probably damaging Het
Cnot7 A G 8: 40,495,921 probably benign Het
Crh T C 3: 19,694,037 E147G probably damaging Het
Cux1 T C 5: 136,363,253 probably benign Het
Cyp2b19 T A 7: 26,766,826 D351E probably benign Het
Dctn1 G T 6: 83,182,632 G31* probably null Het
Duox1 T A 2: 122,346,641 probably benign Het
Egflam T G 15: 7,253,430 E382A possibly damaging Het
Ext1 T C 15: 53,345,146 N73S probably benign Het
Ffar4 A G 19: 38,114,004 probably benign Het
Glg1 A T 8: 111,165,582 M866K probably damaging Het
Golm1 T A 13: 59,645,100 H197L probably benign Het
Gtse1 A G 15: 85,862,378 K132E probably damaging Het
Gxylt2 A T 6: 100,733,378 probably benign Het
Hrc T A 7: 45,336,689 S421R probably benign Het
Ighg2c T A 12: 113,288,168 probably benign Het
Ihh A G 1: 74,946,591 I245T probably benign Het
Ilf3 T A 9: 21,388,714 M65K possibly damaging Het
Insr A G 8: 3,202,947 V404A probably damaging Het
Irak2 G T 6: 113,672,953 probably benign Het
Irak2 G A 6: 113,678,738 V367I probably benign Het
Kat7 A C 11: 95,300,208 N119K probably benign Het
Kif9 A G 9: 110,485,038 I33V probably benign Het
Klf17 A G 4: 117,761,032 Y43H probably benign Het
Kng2 T A 16: 22,987,563 T629S possibly damaging Het
Lama1 A T 17: 67,795,186 probably benign Het
Lamb1 T C 12: 31,278,601 I188T possibly damaging Het
Lpp T A 16: 24,661,800 probably benign Het
Lrp12 T C 15: 39,878,239 E360G probably damaging Het
Mark2 A C 19: 7,283,577 probably benign Het
Mmp3 T C 9: 7,451,910 probably benign Het
Mthfd1l T A 10: 3,978,727 probably benign Het
Mtr A T 13: 12,222,226 S569T probably damaging Het
Myh13 T A 11: 67,367,237 S1752T probably benign Het
Myo5a T A 9: 75,156,207 L565H probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nfkb1 A T 3: 135,595,053 L72* probably null Het
Numa1 A G 7: 102,009,453 K296E probably damaging Het
Olfr1477 A G 19: 13,502,589 E82G probably benign Het
Olfr186 T A 16: 59,027,224 M228L probably benign Het
Olfr201 C T 16: 59,269,211 G152D probably damaging Het
Olfr508 A G 7: 108,630,552 I187V probably benign Het
Olfr613 A T 7: 103,552,322 Y179F probably damaging Het
Pcdhb5 A T 18: 37,321,268 I234F possibly damaging Het
Pgm5 T A 19: 24,684,556 I545F probably damaging Het
Pla2g2c T C 4: 138,743,590 probably benign Het
Pnpla7 A T 2: 25,011,606 E548V probably damaging Het
Ppm1m C A 9: 106,196,696 E273* probably null Het
Ppp2r1b C T 9: 50,861,573 R117* probably null Het
Rabgap1l G A 1: 160,231,789 probably benign Het
Rapgef6 T A 11: 54,546,378 M49K possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rnf219 T A 14: 104,503,344 probably null Het
Rtel1 T G 2: 181,323,405 I146M probably damaging Het
Sdr9c7 A T 10: 127,903,672 M219L probably benign Het
Serpina3g T A 12: 104,240,284 S115T possibly damaging Het
Serpinb1a A T 13: 32,850,276 L44Q probably damaging Het
Slc13a4 A G 6: 35,287,362 I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 L177P probably damaging Het
Slc47a2 C T 11: 61,336,242 V167M possibly damaging Het
Snrnp200 C T 2: 127,234,954 probably benign Het
Snx13 C A 12: 35,101,124 probably benign Het
Snx25 C T 8: 46,041,365 A828T probably damaging Het
Spic A G 10: 88,675,941 L151P probably damaging Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Stk32a T C 18: 43,313,378 probably benign Het
Tbx3 A T 5: 119,680,446 E382V probably damaging Het
Tcaf2 A G 6: 42,629,613 I469T probably benign Het
Tln2 A G 9: 67,240,672 probably benign Het
Top2a T A 11: 98,997,856 I1260L probably benign Het
Treml1 C A 17: 48,364,980 S91* probably null Het
Trim26 T C 17: 36,857,864 probably benign Het
Trmt11 T C 10: 30,535,243 N418S probably benign Het
Ttf1 A G 2: 29,084,655 Y801C probably damaging Het
Usp34 C T 11: 23,464,403 A2782V probably benign Het
Vmn2r77 T C 7: 86,811,650 V728A probably benign Het
Vps4a T C 8: 107,036,701 L29P probably damaging Het
Wdfy3 A G 5: 101,944,033 I480T probably damaging Het
Wdr41 A G 13: 95,010,287 I197V probably damaging Het
Ywhag A T 5: 135,911,299 V147E probably damaging Het
Zan A G 5: 137,403,656 M4058T unknown Het
Zfp236 C T 18: 82,680,692 C88Y probably damaging Het
Other mutations in Camk2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00822:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00932:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00934:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00935:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00938:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL01151:Camk2g APN 14 20765959 missense probably damaging 1.00
IGL01578:Camk2g APN 14 20747854 splice site probably benign
IGL02749:Camk2g APN 14 20766016 critical splice acceptor site probably null
changchun UTSW 14 20742708 nonsense probably null
Jilin UTSW 14 20766212 nonsense probably null
jingyuetan UTSW 14 20793931 missense possibly damaging 0.57
Manchuria UTSW 14 20764949 missense probably damaging 1.00
F5770:Camk2g UTSW 14 20739312 splice site probably benign
R0761:Camk2g UTSW 14 20766212 nonsense probably null
R0783:Camk2g UTSW 14 20744636 missense possibly damaging 0.56
R2239:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R2240:Camk2g UTSW 14 20765446 missense probably damaging 1.00
R2380:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R3623:Camk2g UTSW 14 20755707 splice site probably benign
R3842:Camk2g UTSW 14 20764898 missense probably damaging 0.99
R4909:Camk2g UTSW 14 20792584 missense probably benign 0.29
R5329:Camk2g UTSW 14 20793931 missense possibly damaging 0.57
R5613:Camk2g UTSW 14 20737491 missense probably damaging 0.98
R5763:Camk2g UTSW 14 20739347 missense probably damaging 1.00
R6294:Camk2g UTSW 14 20764949 missense probably damaging 1.00
R6345:Camk2g UTSW 14 20737375 missense probably damaging 1.00
R6698:Camk2g UTSW 14 20742708 nonsense probably null
R7010:Camk2g UTSW 14 20741444 missense probably benign
R7187:Camk2g UTSW 14 20742712 missense probably benign
R7257:Camk2g UTSW 14 20747839 missense probably benign 0.01
R7459:Camk2g UTSW 14 20779207 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCCTCAAGCAATGGGAAGGAGC -3'
(R):5'- TGATTCATTCTCTGAGCCACGAAGC -3'

Sequencing Primer
(F):5'- CAATGGGAAGGAGCCCTCAC -3'
(R):5'- AACCAAGCACTAGTCTCTTGCTG -3'
Posted On2013-05-09