Incidental Mutation 'R4457:Olfr577'
ID329951
Institutional Source Beutler Lab
Gene Symbol Olfr577
Ensembl Gene ENSMUSG00000043354
Gene Nameolfactory receptor 577
SynonymsMOR7-2, GA_x6K02T2PBJ9-5685322-5684384
MMRRC Submission 041717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4457 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102971180-102975943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102973527 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 155 (S155N)
Ref Sequence ENSEMBL: ENSMUSP00000150712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051505] [ENSMUST00000185326] [ENSMUST00000214080] [ENSMUST00000215237]
Predicted Effect probably damaging
Transcript: ENSMUST00000051505
AA Change: S155N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059586
Gene: ENSMUSG00000043354
AA Change: S155N

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 3.3e-140 PFAM
Pfam:7TM_GPCR_Srsx 38 310 1.2e-6 PFAM
Pfam:7tm_1 44 295 7.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185326
SMART Domains Protein: ENSMUSP00000142459
Gene: ENSMUSG00000073962

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 300 9.7e-12 PFAM
Pfam:7tm_1 41 291 1.8e-29 PFAM
Pfam:7tm_4 140 284 2.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214080
AA Change: S155N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215237
AA Change: S155N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A G 16: 90,554,372 noncoding transcript Het
1700025G04Rik T C 1: 151,921,054 R87G probably damaging Het
9030619P08Rik T A 15: 75,431,400 noncoding transcript Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Arhgef5 T C 6: 43,274,093 S593P probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cfap73 T C 5: 120,630,150 K181R possibly damaging Het
Chn1 A G 2: 73,613,083 I383T probably damaging Het
Cmtr2 A G 8: 110,222,252 D398G probably benign Het
Dnah12 T C 14: 26,815,507 Y2238H probably damaging Het
Dnah7c A G 1: 46,740,621 N3161S probably damaging Het
Dnah8 C A 17: 30,813,151 H4148Q probably benign Het
Ehbp1l1 T C 19: 5,716,293 S397G possibly damaging Het
Eya4 A T 10: 23,116,668 S462R probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Frrs1 G A 3: 116,896,728 V7I probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gja10 A T 4: 32,601,073 M437K probably benign Het
Gm2840 T G 5: 96,174,328 noncoding transcript Het
Gm4956 A G 1: 21,298,095 noncoding transcript Het
Gria4 A G 9: 4,427,074 W789R probably damaging Het
Hoxb5 A G 11: 96,303,720 D36G probably damaging Het
Hps5 A T 7: 46,783,613 C228S probably benign Het
Hspa4 A T 11: 53,280,568 C270S probably damaging Het
Htra4 C A 8: 25,038,658 A73S possibly damaging Het
Ikzf2 T C 1: 69,684,188 probably benign Het
Ivl G A 3: 92,572,366 H131Y probably benign Het
Kat6a A G 8: 22,932,113 probably null Het
Lamp3 T A 16: 19,673,529 M322L probably benign Het
Letmd1 T C 15: 100,475,130 V37A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh1 G A 11: 67,220,615 G1627R probably benign Het
Myo9b A G 8: 71,290,999 I235V probably damaging Het
Ndor1 A G 2: 25,248,116 probably null Het
Ndufa12 A T 10: 94,220,818 K136M probably damaging Het
Olfr1174-ps A G 2: 88,310,829 probably benign Het
Olfr1251 A T 2: 89,667,083 S268T probably benign Het
Olfr331 A G 11: 58,502,118 L146P probably damaging Het
Pcdha2 A G 18: 36,940,546 D410G probably damaging Het
Pcyox1l T A 18: 61,697,868 N311I probably benign Het
Pif1 A G 9: 65,587,776 probably benign Het
Pkp1 CTCTTCTT CTCTT 1: 135,875,624 probably null Het
Pogz G A 3: 94,856,063 V49I probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sgms2 A C 3: 131,325,016 Y273D probably damaging Het
Slc25a10 G A 11: 120,497,089 V203I probably benign Het
Slc4a2 T A 5: 24,434,330 probably benign Het
Tbc1d13 A G 2: 30,135,438 probably benign Het
Tdrd7 A G 4: 46,007,526 N526S probably benign Het
Tet2 C T 3: 133,485,563 D1037N possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Usp9y T A Y: 1,394,078 I551L possibly damaging Het
Vwde T C 6: 13,196,101 I308M probably damaging Het
Zan T C 5: 137,411,516 I3488V unknown Het
Zgrf1 A T 3: 127,595,929 I375F probably damaging Het
Zic4 A G 9: 91,379,262 K183R probably damaging Het
Other mutations in Olfr577
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02246:Olfr577 APN 7 102973744 missense possibly damaging 0.62
IGL03111:Olfr577 APN 7 102973531 missense probably damaging 1.00
R1529:Olfr577 UTSW 7 102973879 missense probably damaging 1.00
R1753:Olfr577 UTSW 7 102973056 missense probably benign
R3005:Olfr577 UTSW 7 102973258 missense possibly damaging 0.56
R4675:Olfr577 UTSW 7 102973806 missense probably damaging 0.99
R4808:Olfr577 UTSW 7 102973911 missense probably damaging 0.99
R4891:Olfr577 UTSW 7 102973552 missense probably benign 0.12
R4917:Olfr577 UTSW 7 102973407 missense possibly damaging 0.93
R4918:Olfr577 UTSW 7 102973407 missense possibly damaging 0.93
R5328:Olfr577 UTSW 7 102973968 missense possibly damaging 0.46
R6375:Olfr577 UTSW 7 102973753 missense probably damaging 1.00
R6683:Olfr577 UTSW 7 102973713 missense probably benign 0.05
R6958:Olfr577 UTSW 7 102973884 missense possibly damaging 0.67
R7022:Olfr577 UTSW 7 102973968 missense possibly damaging 0.46
X0027:Olfr577 UTSW 7 102973686 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATGGACAATACGGTGCGC -3'
(R):5'- TGATGCTTGCTTTACCCAGC -3'

Sequencing Primer
(F):5'- GGATGAGCAAAGAGTCCACTCC -3'
(R):5'- AGCTCTTTTTCATCCACTGCTTG -3'
Posted On2015-07-21