Incidental Mutation 'R4457:Pif1'
ID329957
Institutional Source Beutler Lab
Gene Symbol Pif1
Ensembl Gene ENSMUSG00000041064
Gene NamePIF1 5'-to-3' DNA helicase
SynonymsAI449441
MMRRC Submission 041717-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4457 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65587160-65595967 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 65587776 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047099] [ENSMUST00000131483] [ENSMUST00000134538] [ENSMUST00000136205] [ENSMUST00000141046] [ENSMUST00000154970]
Predicted Effect probably benign
Transcript: ENSMUST00000047099
SMART Domains Protein: ENSMUSP00000049046
Gene: ENSMUSG00000041064

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131483
SMART Domains Protein: ENSMUSP00000117494
Gene: ENSMUSG00000041064

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134538
SMART Domains Protein: ENSMUSP00000122060
Gene: ENSMUSG00000041064

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136205
Predicted Effect probably benign
Transcript: ENSMUST00000141046
SMART Domains Protein: ENSMUSP00000120400
Gene: ENSMUSG00000041064

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152885
Predicted Effect probably benign
Transcript: ENSMUST00000154970
SMART Domains Protein: ENSMUSP00000117085
Gene: ENSMUSG00000041064

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 410 1e-14 PFAM
Pfam:PIF1 215 410 8e-59 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent adenosine triphosphate (ATP)-metabolizing enzyme that functions as a 5' to 3' DNA helicase. The encoded protein can resolve G-quadruplex structures and RNA-DNA hybrids at the ends of chromosomes. It also prevents telomere elongation by inhibiting the actions of telomerase. Alternative splicing and the use of alternative start codons results in multiple isoforms that are differentially localized to either the mitochondria or the nucleus. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and show no evidence of increased sensitivity to DNA damage, genetic instability, reproducible telomere length alteration or other cellular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A G 16: 90,554,372 noncoding transcript Het
1700025G04Rik T C 1: 151,921,054 R87G probably damaging Het
9030619P08Rik T A 15: 75,431,400 noncoding transcript Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Arhgef5 T C 6: 43,274,093 S593P probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cfap73 T C 5: 120,630,150 K181R possibly damaging Het
Chn1 A G 2: 73,613,083 I383T probably damaging Het
Cmtr2 A G 8: 110,222,252 D398G probably benign Het
Dnah12 T C 14: 26,815,507 Y2238H probably damaging Het
Dnah7c A G 1: 46,740,621 N3161S probably damaging Het
Dnah8 C A 17: 30,813,151 H4148Q probably benign Het
Ehbp1l1 T C 19: 5,716,293 S397G possibly damaging Het
Eya4 A T 10: 23,116,668 S462R probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Frrs1 G A 3: 116,896,728 V7I probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gja10 A T 4: 32,601,073 M437K probably benign Het
Gm2840 T G 5: 96,174,328 noncoding transcript Het
Gm4956 A G 1: 21,298,095 noncoding transcript Het
Gria4 A G 9: 4,427,074 W789R probably damaging Het
Hoxb5 A G 11: 96,303,720 D36G probably damaging Het
Hps5 A T 7: 46,783,613 C228S probably benign Het
Hspa4 A T 11: 53,280,568 C270S probably damaging Het
Htra4 C A 8: 25,038,658 A73S possibly damaging Het
Ikzf2 T C 1: 69,684,188 probably benign Het
Ivl G A 3: 92,572,366 H131Y probably benign Het
Kat6a A G 8: 22,932,113 probably null Het
Lamp3 T A 16: 19,673,529 M322L probably benign Het
Letmd1 T C 15: 100,475,130 V37A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh1 G A 11: 67,220,615 G1627R probably benign Het
Myo9b A G 8: 71,290,999 I235V probably damaging Het
Ndor1 A G 2: 25,248,116 probably null Het
Ndufa12 A T 10: 94,220,818 K136M probably damaging Het
Olfr1174-ps A G 2: 88,310,829 probably benign Het
Olfr1251 A T 2: 89,667,083 S268T probably benign Het
Olfr331 A G 11: 58,502,118 L146P probably damaging Het
Olfr577 C T 7: 102,973,527 S155N probably damaging Het
Pcdha2 A G 18: 36,940,546 D410G probably damaging Het
Pcyox1l T A 18: 61,697,868 N311I probably benign Het
Pkp1 CTCTTCTT CTCTT 1: 135,875,624 probably null Het
Pogz G A 3: 94,856,063 V49I probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sgms2 A C 3: 131,325,016 Y273D probably damaging Het
Slc25a10 G A 11: 120,497,089 V203I probably benign Het
Slc4a2 T A 5: 24,434,330 probably benign Het
Tbc1d13 A G 2: 30,135,438 probably benign Het
Tdrd7 A G 4: 46,007,526 N526S probably benign Het
Tet2 C T 3: 133,485,563 D1037N possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Usp9y T A Y: 1,394,078 I551L possibly damaging Het
Vwde T C 6: 13,196,101 I308M probably damaging Het
Zan T C 5: 137,411,516 I3488V unknown Het
Zgrf1 A T 3: 127,595,929 I375F probably damaging Het
Zic4 A G 9: 91,379,262 K183R probably damaging Het
Other mutations in Pif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pif1 APN 9 65593277 missense probably damaging 1.00
IGL01343:Pif1 APN 9 65589562 missense probably damaging 1.00
IGL01753:Pif1 APN 9 65593308 missense probably damaging 1.00
R0415:Pif1 UTSW 9 65588051 missense probably benign 0.00
R1087:Pif1 UTSW 9 65589095 missense probably benign
R1742:Pif1 UTSW 9 65587850 missense probably benign 0.12
R1861:Pif1 UTSW 9 65589453 missense probably damaging 1.00
R3804:Pif1 UTSW 9 65588306 missense probably damaging 0.99
R3950:Pif1 UTSW 9 65591834 missense probably damaging 1.00
R4853:Pif1 UTSW 9 65593576 missense probably damaging 1.00
R5192:Pif1 UTSW 9 65588092 missense probably benign 0.02
R5196:Pif1 UTSW 9 65588092 missense probably benign 0.02
R5269:Pif1 UTSW 9 65591829 missense possibly damaging 0.82
R6703:Pif1 UTSW 9 65593263 missense probably damaging 1.00
X0064:Pif1 UTSW 9 65594478 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ATGTGGACATTGCAGGACAATC -3'
(R):5'- GTTCGTTTCGACCTAGGCTC -3'

Sequencing Primer
(F):5'- ATTGCAGGACAATCGCTCG -3'
(R):5'- TCGACCTAGGCTCAGCTCTG -3'
Posted On2015-07-21