Incidental Mutation 'R4458:Lias'
ID329999
Institutional Source Beutler Lab
Gene Symbol Lias
Ensembl Gene ENSMUSG00000029199
Gene Namelipoic acid synthetase
SynonymsmLip1, 4933425M12Rik, MGC7254, 2900022L22Rik, 7a5ex
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location65391497-65410693 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 65394040 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031101] [ENSMUST00000057885] [ENSMUST00000118543] [ENSMUST00000120094] [ENSMUST00000122026] [ENSMUST00000127874] [ENSMUST00000200374] [ENSMUST00000200374]
Predicted Effect probably null
Transcript: ENSMUST00000031101
SMART Domains Protein: ENSMUSP00000031101
Gene: ENSMUSG00000029199

DomainStartEndE-ValueType
Pfam:LIAS_N 4 110 5.8e-49 PFAM
Elp3 126 332 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057885
SMART Domains Protein: ENSMUSP00000109399
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 8.1e-18 PFAM
Pfam:Ribosomal_L6 99 178 7.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118543
SMART Domains Protein: ENSMUSP00000113391
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 1.1e-19 PFAM
Pfam:Ribosomal_L6 99 165 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120094
SMART Domains Protein: ENSMUSP00000113704
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 3e-17 PFAM
Pfam:Ribosomal_L6 99 178 2.9e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122026
SMART Domains Protein: ENSMUSP00000113228
Gene: ENSMUSG00000029199

DomainStartEndE-ValueType
Elp3 42 248 1.42e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127519
Predicted Effect probably benign
Transcript: ENSMUST00000127874
SMART Domains Protein: ENSMUSP00000115577
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 80 3.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147966
Predicted Effect probably benign
Transcript: ENSMUST00000150815
Predicted Effect probably benign
Transcript: ENSMUST00000196667
Predicted Effect probably null
Transcript: ENSMUST00000200374
SMART Domains Protein: ENSMUSP00000143152
Gene: ENSMUSG00000029199

DomainStartEndE-ValueType
Blast:Elp3 2 54 5e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000200374
SMART Domains Protein: ENSMUSP00000143152
Gene: ENSMUSG00000029199

DomainStartEndE-ValueType
Blast:Elp3 2 54 5e-18 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the biotin and lipoic acid synthetases family. It localizes in mitochondrion and plays an important role in alpha-(+)-lipoic acid synthesis. It may also function in the sulfur insertion chemistry in lipoate biosynthesis. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die before weaning. Embryos homozygous for a null allele become growth arrested and die at E7.5-E9.5. Embryos homozygous for an ENU allele survive to E12.5 showing a growth delay, an open neural tube, microcephaly, dilated hearts and lack of dorsal forebrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Lias
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Lias APN 5 65405330 missense probably damaging 1.00
IGL02473:Lias APN 5 65405402 missense possibly damaging 0.95
R6812_Lias_838 UTSW 5 65408789 missense possibly damaging 0.76
R1480:Lias UTSW 5 65392291 missense probably benign
R1677:Lias UTSW 5 65391638 missense probably damaging 1.00
R1836:Lias UTSW 5 65392343 missense probably benign
R4077:Lias UTSW 5 65395425 missense probably benign 0.16
R4438:Lias UTSW 5 65395444 missense probably damaging 1.00
R4710:Lias UTSW 5 65397727 missense probably benign 0.09
R6050:Lias UTSW 5 65393972 missense possibly damaging 0.47
R6812:Lias UTSW 5 65408789 missense possibly damaging 0.76
X0061:Lias UTSW 5 65392360 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAGTTGAGTTAGTTCAGAAACAC -3'
(R):5'- TTGGTCTCATCTGGCACCAC -3'

Sequencing Primer
(F):5'- AAGGCTATGCTGGGAAACTGC -3'
(R):5'- ATCCAAGCACCCAGGAAGTTAGG -3'
Posted On2015-07-21