Incidental Mutation 'R4458:March1'
ID330012
Institutional Source Beutler Lab
Gene Symbol March1
Ensembl Gene ENSMUSG00000036469
Gene Namemembrane-associated ring finger (C3HC4) 1
Synonyms
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location65617900-66471637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66456171 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 177 (A177E)
Ref Sequence ENSEMBL: ENSMUSP00000105888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110258] [ENSMUST00000110259] [ENSMUST00000178982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039540
AA Change: A171E

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469
AA Change: A171E

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072482
AA Change: A177E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469
AA Change: A177E

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098708
AA Change: A181E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469
AA Change: A181E

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110253
AA Change: A171E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469
AA Change: A171E

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110255
AA Change: A181E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469
AA Change: A181E

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110256
AA Change: A432E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469
AA Change: A432E

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110258
AA Change: A181E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469
AA Change: A181E

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110259
AA Change: A177E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469
AA Change: A177E

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152320
Predicted Effect probably damaging
Transcript: ENSMUST00000178982
AA Change: A181E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469
AA Change: A181E

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in March1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:March1 APN 8 66418877 missense possibly damaging 0.88
IGL02468:March1 APN 8 66418911 missense probably damaging 1.00
R0391:March1 UTSW 8 66418973 missense probably damaging 1.00
R1500:March1 UTSW 8 66468390 missense probably damaging 1.00
R1794:March1 UTSW 8 66386942 missense possibly damaging 0.63
R2015:March1 UTSW 8 66121821 missense probably damaging 0.99
R2184:March1 UTSW 8 66387423 missense probably benign 0.07
R2273:March1 UTSW 8 66387499 missense probably benign 0.15
R2274:March1 UTSW 8 66387499 missense probably benign 0.15
R2275:March1 UTSW 8 66387499 missense probably benign 0.15
R2314:March1 UTSW 8 66121790 start codon destroyed probably null 0.77
R3114:March1 UTSW 8 66387381 missense probably benign
R4656:March1 UTSW 8 66386419 missense probably benign 0.05
R4773:March1 UTSW 8 66387224 missense probably benign 0.03
R4838:March1 UTSW 8 66468363 missense probably damaging 1.00
R5073:March1 UTSW 8 66386368 missense probably benign 0.03
R5507:March1 UTSW 8 66418890 missense probably damaging 1.00
R5575:March1 UTSW 8 66468310 missense probably damaging 1.00
R5916:March1 UTSW 8 66387111 missense possibly damaging 0.89
R6931:March1 UTSW 8 66468492 missense probably benign 0.03
R7350:March1 UTSW 8 66468399 nonsense probably null
R7487:March1 UTSW 8 66456074 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATGTTTACACTGTGGATTCCTGTC -3'
(R):5'- TGACAGCGTTGATCAAGGAGAC -3'

Sequencing Primer
(F):5'- TCCTGTCTGGAATGCAAAGTG -3'
(R):5'- GAGACAATTGTAGAGTTTTCCTTGC -3'
Posted On2015-07-21