Incidental Mutation 'R4458:Klhl26'
ID330013
Institutional Source Beutler Lab
Gene Symbol Klhl26
Ensembl Gene ENSMUSG00000055707
Gene Namekelch-like 26
Synonyms
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4458 (G1)
Quality Score223
Status Not validated
Chromosome8
Chromosomal Location70450219-70476968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70452692 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 108 (E108D)
Ref Sequence ENSEMBL: ENSMUSP00000147349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066597] [ENSMUST00000166976] [ENSMUST00000209415] [ENSMUST00000209567] [ENSMUST00000210250]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066597
AA Change: E189D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069077
Gene: ENSMUSG00000055707
AA Change: E189D

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
BTB 54 151 1.56e-26 SMART
BACK 156 257 1.62e-28 SMART
Blast:Kelch 301 352 4e-27 BLAST
Kelch 353 404 1.44e0 SMART
Kelch 405 451 2.86e-4 SMART
Kelch 452 499 1.21e-2 SMART
Kelch 500 550 4.27e-3 SMART
Kelch 551 597 4.93e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166976
AA Change: E128D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129607
Gene: ENSMUSG00000055707
AA Change: E128D

DomainStartEndE-ValueType
Pfam:BTB 19 89 1.7e-13 PFAM
BACK 95 196 1.62e-28 SMART
Blast:Kelch 240 291 4e-27 BLAST
Kelch 292 343 1.44e0 SMART
Kelch 344 390 2.86e-4 SMART
Kelch 391 438 1.21e-2 SMART
Kelch 439 489 4.27e-3 SMART
Kelch 490 536 4.93e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209415
Predicted Effect possibly damaging
Transcript: ENSMUST00000209567
AA Change: E108D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210250
AA Change: E155D

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Klhl26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Klhl26 APN 8 70451883 missense probably damaging 1.00
IGL02508:Klhl26 APN 8 70452731 missense probably damaging 1.00
IGL03089:Klhl26 APN 8 70455633 missense probably benign 0.05
IGL03144:Klhl26 APN 8 70452564 missense probably damaging 1.00
R0365:Klhl26 UTSW 8 70451829 missense probably damaging 1.00
R0408:Klhl26 UTSW 8 70452480 missense probably damaging 1.00
R0494:Klhl26 UTSW 8 70451601 missense probably damaging 1.00
R1889:Klhl26 UTSW 8 70451733 missense probably damaging 0.99
R1940:Klhl26 UTSW 8 70452261 missense probably damaging 1.00
R3902:Klhl26 UTSW 8 70452366 missense probably damaging 0.98
R4459:Klhl26 UTSW 8 70451544 missense probably damaging 1.00
R4460:Klhl26 UTSW 8 70451544 missense probably damaging 1.00
R4461:Klhl26 UTSW 8 70451544 missense probably damaging 1.00
R5135:Klhl26 UTSW 8 70452718 missense probably benign 0.19
R5334:Klhl26 UTSW 8 70452318 missense probably damaging 1.00
R5342:Klhl26 UTSW 8 70455565 missense probably damaging 1.00
R5711:Klhl26 UTSW 8 70452324 missense probably damaging 0.98
R5724:Klhl26 UTSW 8 70451754 missense probably damaging 1.00
R5965:Klhl26 UTSW 8 70452731 missense probably damaging 1.00
R7319:Klhl26 UTSW 8 70452942 missense probably damaging 0.99
R7390:Klhl26 UTSW 8 70452849 missense probably damaging 0.98
Z1088:Klhl26 UTSW 8 70451799 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCACCAGTTCAGCAGGTTG -3'
(R):5'- TGAGGTGACACTGGACCTAGAC -3'

Sequencing Primer
(F):5'- TTGCATGAGCGGGAAGC -3'
(R):5'- ACACTGGACCTAGACTGTGTG -3'
Posted On2015-07-21