Incidental Mutation 'R4458:Sntb2'
ID330015
Institutional Source Beutler Lab
Gene Symbol Sntb2
Ensembl Gene ENSMUSG00000041308
Gene Namesyntrophin, basic 2
SynonymsSnt2
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106935750-107019714 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 106991607 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047425] [ENSMUST00000212524]
Predicted Effect probably null
Transcript: ENSMUST00000047425
SMART Domains Protein: ENSMUSP00000037324
Gene: ENSMUSG00000041308

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 62 92 N/A INTRINSIC
low complexity region 93 99 N/A INTRINSIC
PDZ 104 178 1.48e-17 SMART
PH 144 282 3.52e0 SMART
PH 306 419 4.07e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000212524
Meta Mutation Damage Score 0.65 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have no overt phenotype. They are fertile and motile with no signs of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Sntb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Sntb2 UTSW 8 107001583 missense probably damaging 1.00
R0345:Sntb2 UTSW 8 107001538 missense probably damaging 1.00
R0766:Sntb2 UTSW 8 107001577 missense probably damaging 1.00
R1027:Sntb2 UTSW 8 106991571 missense probably benign 0.28
R1312:Sntb2 UTSW 8 107001577 missense probably damaging 1.00
R1514:Sntb2 UTSW 8 106991532 missense probably damaging 1.00
R1942:Sntb2 UTSW 8 107011352 missense probably damaging 0.98
R2937:Sntb2 UTSW 8 106936097 missense probably benign 0.06
R3968:Sntb2 UTSW 8 106997140 nonsense probably null
R4455:Sntb2 UTSW 8 106991607 critical splice donor site probably null
R4526:Sntb2 UTSW 8 107009963 missense probably damaging 0.99
R6123:Sntb2 UTSW 8 106981225 missense probably damaging 1.00
R7378:Sntb2 UTSW 8 106981312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTACGCTGCAAGGATACGG -3'
(R):5'- CCATGCTGCTTAGAAGGAGAAATG -3'

Sequencing Primer
(F):5'- CTGCAAGGATACGGCCACAG -3'
(R):5'- CATCAAGGTTAATTCTGCTGCTAGG -3'
Posted On2015-07-21