Incidental Mutation 'R4458:Kpnb1'
ID 330025
Institutional Source Beutler Lab
Gene Symbol Kpnb1
Ensembl Gene ENSMUSG00000001440
Gene Name karyopherin subunit beta 1
Synonyms Impnb
MMRRC Submission 041718-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4458 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 97050540-97078707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 97059996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 558 (L558Q)
Ref Sequence ENSEMBL: ENSMUSP00000001479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001479]
AlphaFold P70168
PDB Structure N-TERMINAL FRAGMENT OF IMPORTIN-BETA [X-RAY DIFFRACTION]
Crystal structure of Importin-beta and SREBP-2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000001479
AA Change: L558Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001479
Gene: ENSMUSG00000001440
AA Change: L558Q

DomainStartEndE-ValueType
IBN_N 21 101 3.72e-5 SMART
Blast:ARM 158 203 4e-7 BLAST
Pfam:HEAT_EZ 380 435 3e-13 PFAM
Pfam:HEAT 409 439 2.6e-7 PFAM
Blast:ARM 440 477 7e-17 BLAST
low complexity region 478 495 N/A INTRINSIC
Blast:IBN_N 528 590 9e-25 BLAST
Blast:ARM 594 637 1e-18 BLAST
Blast:ARM 784 827 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153727
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,139,997 (GRCm39) probably null Het
Akap13 A G 7: 75,389,213 (GRCm39) D2377G probably damaging Het
Ankrd44 A T 1: 54,801,550 (GRCm39) I56N possibly damaging Het
Apob T A 12: 8,065,445 (GRCm39) I4105N probably damaging Het
Arhgap5 T A 12: 52,564,740 (GRCm39) N570K probably benign Het
Arid1b A T 17: 5,293,191 (GRCm39) Q703L probably damaging Het
Atp4a G A 7: 30,419,650 (GRCm39) R671Q probably benign Het
Cad T A 5: 31,218,570 (GRCm39) V499D probably damaging Het
Cdkn2d C G 9: 21,202,185 (GRCm39) V21L probably benign Het
Celsr2 A C 3: 108,302,313 (GRCm39) I2605S probably damaging Het
Chd6 T A 2: 160,871,796 (GRCm39) Y213F possibly damaging Het
Clec18a T A 8: 111,802,102 (GRCm39) T296S probably damaging Het
Crybg2 C T 4: 133,802,205 (GRCm39) P1122S probably benign Het
Cyld G T 8: 89,445,929 (GRCm39) S309I probably benign Het
Dctn5 G T 7: 121,734,303 (GRCm39) R49L probably damaging Het
Egr2 GAA GA 10: 67,375,733 (GRCm39) probably null Het
Erbin C A 13: 103,970,065 (GRCm39) V1184F probably damaging Het
Ercc2 G T 7: 19,127,771 (GRCm39) R406L probably damaging Het
Eya1 C T 1: 14,253,420 (GRCm39) V519M probably damaging Het
Flad1 T C 3: 89,316,241 (GRCm39) H107R probably benign Het
Fsip2 G T 2: 82,821,120 (GRCm39) A5618S possibly damaging Het
Gabbr1 G T 17: 37,378,667 (GRCm39) probably null Het
Haghl A T 17: 26,003,994 (GRCm39) V30E probably damaging Het
Itga5 C T 15: 103,258,630 (GRCm39) E822K probably damaging Het
Klhl26 T A 8: 70,905,342 (GRCm39) E108D possibly damaging Het
Lias T C 5: 65,551,383 (GRCm39) probably null Het
Ltbp1 A T 17: 75,583,502 (GRCm39) K434M possibly damaging Het
Marchf1 C A 8: 66,908,823 (GRCm39) A177E probably damaging Het
Naip2 T A 13: 100,291,419 (GRCm39) H1173L probably benign Het
Nol4 T C 18: 22,885,052 (GRCm39) I419V probably damaging Het
Nol6 A G 4: 41,115,888 (GRCm39) L1068P probably damaging Het
Nrcam T C 12: 44,606,513 (GRCm39) S420P probably damaging Het
Or10c1 A T 17: 37,522,204 (GRCm39) I180N possibly damaging Het
Pitpnm2 T C 5: 124,259,439 (GRCm39) T1299A probably benign Het
Prdm16 A G 4: 154,406,765 (GRCm39) V1220A probably benign Het
Saraf T C 8: 34,621,870 (GRCm39) S25P unknown Het
Serpine3 C A 14: 62,911,922 (GRCm39) L295I probably damaging Het
Sntb2 G A 8: 107,718,239 (GRCm39) probably null Het
Surf6 T C 2: 26,782,721 (GRCm39) E202G probably benign Het
Tent5a T C 9: 85,208,527 (GRCm39) I99V possibly damaging Het
Th A T 7: 142,450,690 (GRCm39) D135E probably benign Het
Traf1 A G 2: 34,835,445 (GRCm39) Y326H probably damaging Het
Tshz2 G A 2: 169,727,008 (GRCm39) A66T probably benign Het
Ttn T C 2: 76,777,257 (GRCm39) M1382V probably benign Het
Ubqlnl A G 7: 103,798,396 (GRCm39) V367A probably benign Het
Uspl1 T A 5: 149,150,962 (GRCm39) S707T possibly damaging Het
Utp18 A G 11: 93,761,359 (GRCm39) S350P possibly damaging Het
Vmn1r177 A G 7: 23,565,645 (GRCm39) V77A possibly damaging Het
Vmn1r229 A G 17: 21,034,894 (GRCm39) I46M probably damaging Het
Vnn3 T C 10: 23,741,567 (GRCm39) Y291H probably benign Het
Vps9d1 A G 8: 123,974,487 (GRCm39) S267P probably benign Het
Wrn T A 8: 33,785,026 (GRCm39) T692S probably damaging Het
Yeats2 T C 16: 20,032,071 (GRCm39) I19T probably damaging Het
Zfp13 G A 17: 23,800,150 (GRCm39) A36V probably benign Het
Other mutations in Kpnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Kpnb1 APN 11 97,056,928 (GRCm39) missense probably damaging 1.00
IGL01919:Kpnb1 APN 11 97,055,556 (GRCm39) missense probably benign
IGL02161:Kpnb1 APN 11 97,059,762 (GRCm39) missense probably benign 0.01
IGL02679:Kpnb1 APN 11 97,068,086 (GRCm39) missense possibly damaging 0.92
IGL02866:Kpnb1 APN 11 97,068,112 (GRCm39) missense probably damaging 0.99
IGL02899:Kpnb1 APN 11 97,066,612 (GRCm39) missense probably damaging 1.00
R0373:Kpnb1 UTSW 11 97,075,916 (GRCm39) missense probably damaging 1.00
R0542:Kpnb1 UTSW 11 97,078,398 (GRCm39) missense probably benign 0.12
R0724:Kpnb1 UTSW 11 97,069,130 (GRCm39) missense probably damaging 1.00
R0825:Kpnb1 UTSW 11 97,062,501 (GRCm39) missense probably damaging 0.98
R0853:Kpnb1 UTSW 11 97,078,237 (GRCm39) missense probably damaging 0.97
R1481:Kpnb1 UTSW 11 97,069,136 (GRCm39) missense probably damaging 1.00
R3802:Kpnb1 UTSW 11 97,056,955 (GRCm39) missense possibly damaging 0.92
R4490:Kpnb1 UTSW 11 97,062,424 (GRCm39) missense probably benign
R4757:Kpnb1 UTSW 11 97,068,160 (GRCm39) missense possibly damaging 0.65
R5500:Kpnb1 UTSW 11 97,063,937 (GRCm39) missense possibly damaging 0.94
R6360:Kpnb1 UTSW 11 97,064,096 (GRCm39) missense probably benign
R6494:Kpnb1 UTSW 11 97,072,474 (GRCm39) missense probably benign 0.04
R7678:Kpnb1 UTSW 11 97,059,999 (GRCm39) missense probably damaging 1.00
R8171:Kpnb1 UTSW 11 97,066,573 (GRCm39) critical splice donor site probably null
R8874:Kpnb1 UTSW 11 97,056,209 (GRCm39) missense probably benign 0.25
R9318:Kpnb1 UTSW 11 97,054,284 (GRCm39) missense probably benign
R9621:Kpnb1 UTSW 11 97,058,460 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTGCAATGTAACAGGGAGC -3'
(R):5'- ATGTCTCTGAACTGCATCCC -3'

Sequencing Primer
(F):5'- CAGCACGCTGAGAGCTTTTTG -3'
(R):5'- TGAACTGCATCCCCAACCTCTG -3'
Posted On 2015-07-21