Incidental Mutation 'R4458:Arid1b'
ID330035
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene NameAT rich interactive domain 1B (SWI-like)
SynonymsB230217J03Rik, 9330189K18Rik
MMRRC Submission 041718-MU
Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location4994332-5347656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5242916 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 703 (Q703L)
Ref Sequence ENSEMBL: ENSMUSP00000090398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
Predicted Effect probably damaging
Transcript: ENSMUST00000092723
AA Change: Q703L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: Q703L

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115797
AA Change: Q651L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: Q651L

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115799
AA Change: Q199L

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: Q199L

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232180
AA Change: Q703L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5337110 missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5321284 missense probably damaging 1.00
IGL00886:Arid1b APN 17 5126979 missense probably damaging 0.99
IGL01161:Arid1b APN 17 5342399 missense probably damaging 1.00
IGL01391:Arid1b APN 17 5318858 splice site probably benign
IGL01456:Arid1b APN 17 5291235 missense probably damaging 1.00
IGL02152:Arid1b APN 17 5313968 missense probably damaging 1.00
IGL02288:Arid1b APN 17 5264040 missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5343011 missense probably damaging 1.00
IGL02858:Arid1b APN 17 5341891 missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5342153 missense probably damaging 1.00
IGL02989:Arid1b APN 17 5335047 missense probably damaging 1.00
FR4449:Arid1b UTSW 17 4995589 small insertion probably benign
PIT4142001:Arid1b UTSW 17 5339243 missense probably damaging 1.00
R0048:Arid1b UTSW 17 5314034 critical splice donor site probably null
R0124:Arid1b UTSW 17 5339330 missense probably damaging 1.00
R0153:Arid1b UTSW 17 5342932 missense probably damaging 1.00
R0465:Arid1b UTSW 17 4996260 missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5342178 missense probably damaging 1.00
R1172:Arid1b UTSW 17 5339300 missense probably damaging 1.00
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1616:Arid1b UTSW 17 5339294 missense probably damaging 1.00
R1754:Arid1b UTSW 17 5279201 critical splice acceptor site probably null
R1760:Arid1b UTSW 17 5341813 missense probably damaging 0.97
R1812:Arid1b UTSW 17 5337029 missense probably benign 0.10
R1911:Arid1b UTSW 17 5342966 missense probably damaging 1.00
R3874:Arid1b UTSW 17 5336515 splice site probably null
R3913:Arid1b UTSW 17 5342257 missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5342653 missense probably benign 0.25
R3922:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R4119:Arid1b UTSW 17 4995794 unclassified probably benign
R4290:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4291:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4352:Arid1b UTSW 17 5097584 missense possibly damaging 0.93
R4386:Arid1b UTSW 17 4994972 unclassified probably benign
R4524:Arid1b UTSW 17 5097620 missense possibly damaging 0.93
R4622:Arid1b UTSW 17 4995050 unclassified probably benign
R4723:Arid1b UTSW 17 5337290 missense probably benign 0.01
R4782:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4799:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4910:Arid1b UTSW 17 5342203 missense probably damaging 1.00
R4946:Arid1b UTSW 17 5342843 missense probably damaging 0.99
R5083:Arid1b UTSW 17 5314018 missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R5347:Arid1b UTSW 17 5291057 nonsense probably null
R5553:Arid1b UTSW 17 5313877 missense probably damaging 1.00
R5713:Arid1b UTSW 17 5336816 missense probably damaging 1.00
R5820:Arid1b UTSW 17 4996254 missense possibly damaging 0.96
R5992:Arid1b UTSW 17 4994956 unclassified probably benign
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6153:Arid1b UTSW 17 5242832 missense probably damaging 1.00
R6222:Arid1b UTSW 17 5327647 critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5279361 missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5341999 missense probably damaging 1.00
R6329:Arid1b UTSW 17 5337263 nonsense probably null
R6368:Arid1b UTSW 17 5332533 missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5327678 missense probably damaging 1.00
R6861:Arid1b UTSW 17 5327686 missense possibly damaging 0.93
X0023:Arid1b UTSW 17 5342393 missense probably benign 0.39
X0027:Arid1b UTSW 17 5342372 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACTGTGGCTTTCAAACC -3'
(R):5'- CCAGACCTGTCTTCACATGG -3'

Sequencing Primer
(F):5'- AAACCATGCTTCCCGTGC -3'
(R):5'- ACCTGTCTTCACATGGGGCTG -3'
Posted On2015-07-21