Incidental Mutation 'R4459:Smg8'
ID330068
Institutional Source Beutler Lab
Gene Symbol Smg8
Ensembl Gene ENSMUSG00000020495
Gene Namesmg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms1200011M11Rik
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R4459 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87077732-87086774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87085570 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 395 (D395G)
Ref Sequence ENSEMBL: ENSMUSP00000020801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020801] [ENSMUST00000051395] [ENSMUST00000143280]
Predicted Effect probably benign
Transcript: ENSMUST00000020801
AA Change: D395G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020801
Gene: ENSMUSG00000020495
AA Change: D395G

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
Pfam:DUF2146 41 985 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051395
SMART Domains Protein: ENSMUSP00000060803
Gene: ENSMUSG00000020493

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
low complexity region 135 152 N/A INTRINSIC
low complexity region 184 212 N/A INTRINSIC
low complexity region 350 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143280
SMART Domains Protein: ENSMUSP00000119011
Gene: ENSMUSG00000020495

DomainStartEndE-ValueType
Pfam:DUF2146 1 269 2.9e-89 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Anks1b G A 10: 90,510,844 V669I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Cyp11b1 T A 15: 74,836,359 E422D probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Efcab6 C T 15: 83,904,289 G935S probably damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gc T C 5: 89,441,287 M206V probably benign Het
Gm15446 A T 5: 109,943,241 H453L probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighg2b T C 12: 113,306,958 Y184C unknown Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr112 G A 17: 37,563,474 T279I probably damaging Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Prl7a2 A G 13: 27,665,996 V31A probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Smg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Smg8 APN 11 87078041 missense probably damaging 0.96
IGL01591:Smg8 APN 11 87085153 missense probably damaging 1.00
IGL01844:Smg8 APN 11 87080276 missense probably damaging 1.00
IGL02634:Smg8 APN 11 87086672 missense probably benign
IGL03170:Smg8 APN 11 87086608 missense probably damaging 1.00
IGL03206:Smg8 APN 11 87085988 unclassified probably null
R0218:Smg8 UTSW 11 87086122 missense probably damaging 1.00
R0378:Smg8 UTSW 11 87080423 missense probably damaging 1.00
R0497:Smg8 UTSW 11 87086084 missense possibly damaging 0.95
R0522:Smg8 UTSW 11 87086462 missense probably benign
R0546:Smg8 UTSW 11 87083613 missense possibly damaging 0.69
R0634:Smg8 UTSW 11 87086108 missense possibly damaging 0.86
R1245:Smg8 UTSW 11 87083610 missense possibly damaging 0.91
R1710:Smg8 UTSW 11 87086287 missense probably damaging 0.98
R1726:Smg8 UTSW 11 87080613 nonsense probably null
R1747:Smg8 UTSW 11 87085303 missense possibly damaging 0.93
R1748:Smg8 UTSW 11 87085768 missense probably damaging 1.00
R1909:Smg8 UTSW 11 87080613 nonsense probably null
R1981:Smg8 UTSW 11 87085331 missense probably benign 0.00
R2356:Smg8 UTSW 11 87085728 missense probably benign 0.00
R4724:Smg8 UTSW 11 87086221 missense probably benign 0.39
R4914:Smg8 UTSW 11 87080710 missense probably damaging 1.00
R5023:Smg8 UTSW 11 87086137 missense probably damaging 1.00
R5284:Smg8 UTSW 11 87080311 missense possibly damaging 0.94
R5368:Smg8 UTSW 11 87080260 missense probably benign 0.21
R5534:Smg8 UTSW 11 87085470 missense probably benign 0.06
R5689:Smg8 UTSW 11 87085123 missense probably damaging 0.98
R6651:Smg8 UTSW 11 87086546 missense probably benign 0.30
R6896:Smg8 UTSW 11 87077961 missense possibly damaging 0.46
X0028:Smg8 UTSW 11 87086122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACTTCATACAACTTTGCTG -3'
(R):5'- CTTTACGGTACCTGCCAACC -3'

Sequencing Primer
(F):5'- TGCTGCAGAGATCCACTTCTGG -3'
(R):5'- TTTGTGTACATAGTCCCCGGAAGC -3'
Posted On2015-07-21