Incidental Mutation 'R4460:Zfp804b'
ID330097
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
SynonymsLOC207618
MMRRC Submission 041719-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4460 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6771481 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 491 (D491E)
Ref Sequence ENSEMBL: ENSMUSP00000130571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]
Predicted Effect probably damaging
Transcript: ENSMUST00000164784
AA Change: D491E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: D491E

DomainStartEndE-ValueType
ZnF_C2H2 20 44 4.81e0 SMART
low complexity region 922 934 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
low complexity region 1160 1171 N/A INTRINSIC
low complexity region 1179 1198 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200317
AA Change: D527E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: D527E

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,152,856 T1268I probably benign Het
A830010M20Rik A G 5: 107,503,765 T687A possibly damaging Het
C030048H21Rik A G 2: 26,255,863 probably null Het
Cav1 A G 6: 17,306,472 D8G probably damaging Het
Celf6 G A 9: 59,603,044 R103H probably damaging Het
Ctr9 A G 7: 111,046,894 I698V probably benign Het
Cts6 G C 13: 61,195,458 I316M probably benign Het
Dnajc13 C A 9: 104,181,063 R1496L probably damaging Het
Dscam A G 16: 96,610,319 Y1786H probably damaging Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Ltk A G 2: 119,755,613 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mmp9 G T 2: 164,949,038 K115N probably damaging Het
Mroh5 A T 15: 73,791,796 D339E probably damaging Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Mx1 G T 16: 97,454,081 S113R probably damaging Het
Nlrp9c T A 7: 26,378,098 H698L probably damaging Het
Nol9 T G 4: 152,057,836 L641R probably damaging Het
Park2 A T 17: 12,061,646 D463V probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Ptcd1 G T 5: 145,159,506 A259E probably benign Het
Ptov1 T C 7: 44,865,576 M204V probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rbbp8nl A G 2: 180,280,971 S210P probably benign Het
Rgmb C A 17: 15,807,626 R277L probably benign Het
Snx2 A G 18: 53,176,444 E22G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tmem143 C T 7: 45,906,952 T97I probably damaging Het
Ttn A C 2: 76,814,647 F12955V probably damaging Het
Ubr2 C T 17: 46,945,045 probably null Het
Vmn1r203 T A 13: 22,524,682 M211K probably damaging Het
Vmn2r121 G A X: 124,128,584 P580S probably benign Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1677:Zfp804b UTSW 5 7179533 intron probably benign
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1747:Zfp804b UTSW 5 6770217 missense probably benign 0.27
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1804:Zfp804b UTSW 5 6771756 missense possibly damaging 0.78
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2181:Zfp804b UTSW 5 6771674 missense probably damaging 1.00
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3237:Zfp804b UTSW 5 6769239 missense probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R3785:Zfp804b UTSW 5 6770153 missense possibly damaging 0.90
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6252:Zfp804b UTSW 5 6769478 missense probably damaging 0.99
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6924:Zfp804b UTSW 5 6769902 missense probably benign 0.09
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense probably benign 0.02
R7099:Zfp804b UTSW 5 6772161 missense probably benign 0.37
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCATCCTTTAGAGACAGCTTAAG -3'
(R):5'- AGTGGCCTACAGAACTTCTCTTC -3'

Sequencing Primer
(F):5'- CTTAAGGTAAGCAGGCACTTCAG -3'
(R):5'- TTCTTTACCAGAACAGAACCTTGC -3'
Posted On2015-07-21